ID: 1162839020

View in Genome Browser
Species Human (GRCh38)
Location 19:13341902-13341924
Sequence TGTGCCAGATGTTGTCCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162839020_1162839024 -2 Left 1162839020 19:13341902-13341924 CCCCTAGGACAACATCTGGCACA No data
Right 1162839024 19:13341923-13341945 CACAGTCGGTGCTCAATAAGTGG No data
1162839020_1162839025 24 Left 1162839020 19:13341902-13341924 CCCCTAGGACAACATCTGGCACA No data
Right 1162839025 19:13341949-13341971 CTGTTGAATGACTGATTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162839020 Original CRISPR TGTGCCAGATGTTGTCCTAG GGG (reversed) Intronic