ID: 1162839020

View in Genome Browser
Species Human (GRCh38)
Location 19:13341902-13341924
Sequence TGTGCCAGATGTTGTCCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162839020_1162839025 24 Left 1162839020 19:13341902-13341924 CCCCTAGGACAACATCTGGCACA 0: 1
1: 0
2: 3
3: 29
4: 186
Right 1162839025 19:13341949-13341971 CTGTTGAATGACTGATTGAGAGG 0: 1
1: 0
2: 4
3: 54
4: 356
1162839020_1162839024 -2 Left 1162839020 19:13341902-13341924 CCCCTAGGACAACATCTGGCACA 0: 1
1: 0
2: 3
3: 29
4: 186
Right 1162839024 19:13341923-13341945 CACAGTCGGTGCTCAATAAGTGG 0: 1
1: 2
2: 24
3: 130
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162839020 Original CRISPR TGTGCCAGATGTTGTCCTAG GGG (reversed) Intronic
901321761 1:8344328-8344350 TTTGCCAGATGTCTTCCTGGGGG - Intergenic
902211138 1:14905457-14905479 TGTGCCAGATGCAGGCCTGGGGG - Intronic
903391775 1:22969516-22969538 TGTGCCAGACGCTGTTCTACAGG + Intergenic
903651114 1:24922994-24923016 TGTGCCGGATGCCGTCCTAGGGG - Intronic
905335273 1:37240615-37240637 TGTGCCAGATATTGTGCCAAGGG + Intergenic
906436420 1:45800678-45800700 TGGGCCGGAGGCTGTCCTAGAGG + Intronic
906865207 1:49410887-49410909 TATGCCAGATGCTGTACTAAGGG + Intronic
907774197 1:57497350-57497372 TGTGCCAGACATTATTCTAGTGG - Intronic
911584397 1:99673802-99673824 TGTGCTAGGCGTTGTACTAGGGG - Intronic
912130304 1:106591301-106591323 GGTACCAGAAGTTGTTCTAGAGG - Intergenic
912252248 1:108023047-108023069 GGTGCCAGGAGTTGTTCTAGAGG - Intergenic
912538499 1:110394942-110394964 TGTGCCAGACGCTGTGCCAGAGG + Intergenic
912723812 1:112041859-112041881 TGTGTCAGATGATGTCCCAAGGG + Intergenic
913272771 1:117110331-117110353 TTTGCCAGATGTCCTCTTAGGGG + Intergenic
916582330 1:166120149-166120171 TGTGCCAGGTGCTGTGCTGGGGG + Intronic
916682901 1:167120463-167120485 TGTGCCAGGTGTTGTCCCAAGGG - Intronic
917999910 1:180483516-180483538 TGTGCAAGTTGTAGTTCTAGGGG - Intronic
921088219 1:211816353-211816375 TGTGTCAGATATTGTGCTGGTGG - Intronic
924937295 1:248782940-248782962 TATGCCAGATGTTATGCTTGGGG - Intergenic
1067894495 10:50164313-50164335 GGTGCCAGATACTGTGCTAGGGG - Intergenic
1067954348 10:50775948-50775970 GGTGCCAGATACTGTGCTAGGGG + Intronic
1068826352 10:61444251-61444273 TGTACCAGATGCTGTCATGGTGG - Intronic
1070315212 10:75303705-75303727 TGTGTCAGATGGTGTGCTAGAGG + Intergenic
1071619651 10:87107663-87107685 TGTGACTGTGGTTGTCCTAGTGG + Intronic
1071907178 10:90187206-90187228 TATGCCAGATACTGTTCTAGGGG - Intergenic
1072253783 10:93601403-93601425 TGTGCCCGAGGCTGTCCTGGAGG - Exonic
1072735300 10:97875018-97875040 TGTGCTGGATGTTGTTCTAGTGG - Intronic
1073048391 10:100653354-100653376 TGTGCCCCATGCTGTCCTGGGGG + Intergenic
1075106051 10:119540841-119540863 TGTGCCACACATTGTACTAGGGG + Intronic
1075204941 10:120438867-120438889 TGTGCCAGGTATTTTTCTAGGGG + Intergenic
1078854595 11:15196728-15196750 TGTGCCAGATAATGTTCTAAGGG + Intronic
1079000033 11:16744964-16744986 TTTGCCATATGTTGGCCCAGTGG + Intronic
1080117305 11:28635423-28635445 TGTGTCAGGTGTTGTGCTAGAGG - Intergenic
1085067645 11:73512045-73512067 TGTGCCAGGTATTGTTTTAGGGG - Intronic
1086281018 11:85188853-85188875 TGTGTTTGATGTTGTCCTAGAGG - Intronic
1086849205 11:91789220-91789242 TGTCCCATATATTGTGCTAGTGG + Intergenic
1088539109 11:110894568-110894590 TGTGCCACGTATTGTGCTAGAGG - Intergenic
1090235530 11:125144101-125144123 TGTCCCAGGTGTTGTTTTAGGGG - Intergenic
1091320180 11:134643894-134643916 TGTGTCAGATGTTGTCGTGGGGG - Intergenic
1091608211 12:1976790-1976812 TGTGCCAGACATTGTTTTAGAGG - Intronic
1092880424 12:12883857-12883879 TGTGCAAGATGGTGCCATAGAGG + Intergenic
1094744603 12:33330375-33330397 GCTGCCAGATCCTGTCCTAGTGG + Intergenic
1095293906 12:40507006-40507028 TGTGCCAGGAGTTGCCCTAGTGG - Intronic
1095821731 12:46486089-46486111 TGTGTCAGGTATTGTGCTAGAGG + Intergenic
1095851380 12:46811144-46811166 TGTGCCAGATTTTATGCTAGGGG + Intronic
1096419645 12:51445914-51445936 TGTGCCAGATCCTGTCCCAAGGG - Intronic
1100736006 12:97532266-97532288 TGTGCCAGACATTGGGCTAGGGG - Intergenic
1100888153 12:99095328-99095350 TGTGACAGAAGTTGTCATTGGGG + Intronic
1101510321 12:105387159-105387181 AGTGCAAGATGTTGACTTAGAGG + Intronic
1102108507 12:110346034-110346056 CGAGCCAGATGTTCTCCCAGGGG - Exonic
1104444967 12:128825157-128825179 TGTGCCAGGCGCTGTCCCAGAGG - Intergenic
1105309467 13:19193416-19193438 TGGGCCTGATGTTGTCTTTGTGG - Intergenic
1112197899 13:97243328-97243350 TGTGTCGGATGCTGTACTAGGGG + Intronic
1113038595 13:106079670-106079692 TGGGCCAGATGTTTTTCTTGTGG - Intergenic
1115966535 14:38896066-38896088 TGTGCAAGATTTTGTACTAAAGG + Intergenic
1119442195 14:74636016-74636038 TGTCCCAGGTGCTGTGCTAGGGG + Intergenic
1120077108 14:80171562-80171584 TCTGCCATATGTTGTCTGAGTGG + Intergenic
1120856323 14:89215978-89216000 TTTGCCAAGTGTTGTTCTAGAGG + Intronic
1124423305 15:29540915-29540937 TATCCTAGATGATGTCCTAGTGG + Intronic
1127300744 15:57651214-57651236 TGTGCCAGATGTGGAGCTAGGGG + Intronic
1128168504 15:65489313-65489335 TTTGCCAGTTTTTCTCCTAGAGG - Intronic
1129118071 15:73376472-73376494 TGTGACAGAGGTTGTGATAGAGG + Intergenic
1129118128 15:73377382-73377404 TGTGACAGAGGTTGTGATAGAGG + Intergenic
1129482872 15:75842347-75842369 TGTGCCAGGAATTGTGCTAGTGG + Intergenic
1131180356 15:90234806-90234828 TGTGCCAAACATTATCCTAGAGG - Intronic
1132306894 15:100821816-100821838 TGTGCCAGATATTGGCAGAGTGG - Intergenic
1137486124 16:48892858-48892880 TGTGCCAGATGCTGTTTTAAGGG + Intergenic
1137528844 16:49263305-49263327 TGAGCCAGATATTGTTCCAGGGG - Intergenic
1138310480 16:56019389-56019411 TGAGCCAGATGTTCCCCTGGAGG + Intergenic
1138945142 16:61840478-61840500 TGTGCCAGGTATTTTTCTAGGGG - Intronic
1140151532 16:72372221-72372243 TGTGCCAGATAGAGGCCTAGGGG - Intergenic
1141256257 16:82405162-82405184 TGTGCAAGATGGTATTCTAGGGG + Intergenic
1141346685 16:83253033-83253055 TGTGCCAGGTGCTGTGCTAAGGG - Intronic
1141981602 16:87553727-87553749 TGTGCTTGCTGTTCTCCTAGTGG + Intergenic
1143724094 17:8833456-8833478 TGCACCAGGTGTTGTTCTAGGGG + Intronic
1144266092 17:13571205-13571227 TGTGACACATGTAGTTCTAGAGG + Intronic
1144839609 17:18177782-18177804 TGTGCCAGGCCTTGTCCTAAAGG - Intronic
1148534956 17:48430967-48430989 AGTGCCAGATGTTACCCTTGGGG + Intergenic
1150468323 17:65414478-65414500 TGTGGCAAATGTTTTCCTAGTGG + Intergenic
1150981374 17:70145734-70145756 TGTGCTAGATTTTGTCTTAAGGG - Intergenic
1153817800 18:8806368-8806390 AGTGCCAGATGTTGTACTAGAGG - Intronic
1160600724 18:80010684-80010706 TGTGCAAGATTTTATCCAAGTGG + Intronic
1162449022 19:10743257-10743279 TGTGCCAGATAGTGTGCTGGAGG + Intronic
1162839020 19:13341902-13341924 TGTGCCAGATGTTGTCCTAGGGG - Intronic
1163034220 19:14562193-14562215 TGTGCCAGATGTAACCCGAGTGG - Intronic
1163376086 19:16931384-16931406 TGTGCCAGCTGTGGTGTTAGTGG - Intronic
1163711649 19:18850712-18850734 TGTCCCAGTTGATGTCCTTGAGG - Exonic
1166589058 19:43979771-43979793 TGTTCCAGAAGTGGTTCTAGAGG + Intronic
1167750606 19:51377650-51377672 TGTGCCAGGTGCTGTCTTTGAGG + Intergenic
925911302 2:8575201-8575223 TAGGCCAGATGTTGGCCAAGGGG + Intergenic
926036054 2:9636805-9636827 CGTGCCAGATGCTGTCCTAAGGG + Intergenic
926897429 2:17709621-17709643 TGTGCCAGGTGCTGTTCCAGAGG + Intronic
931145237 2:59509395-59509417 GGTGCCAGATGTTGATATAGGGG + Intergenic
931162468 2:59707834-59707856 TGTGTCAGATGCTGTGCTAAGGG + Intergenic
932131537 2:69192017-69192039 AGCACCAGATGTTGTCCTAAGGG + Intronic
934604913 2:95687290-95687312 TGTGTCAGGTGTTGTGCTAGTGG + Intergenic
934605603 2:95692902-95692924 TGTGCCTGACATTGTCCTAGGGG + Intergenic
935852918 2:107242756-107242778 TGCAACAGATGTTGTCCTATTGG + Intergenic
935865431 2:107382431-107382453 TGTGCCAGATGTTGTTCTGGGGG - Intergenic
936539069 2:113335442-113335464 TGTGCCTGACATTGTCCTAGGGG + Intergenic
936548986 2:113418453-113418475 TGTGCCAAATGTTCTCCAGGAGG - Intergenic
936579185 2:113681786-113681808 TGTGCTTGATGTTGTCCCAGAGG - Intergenic
937192148 2:120112776-120112798 TGTGCCAGACATTGTTCTGGAGG + Intronic
939569900 2:143828959-143828981 CCTGCCAGATGATGGCCTAGAGG - Intergenic
939671081 2:145013290-145013312 TGTGCCAGGTGTTGTTCTACAGG + Intergenic
940586573 2:155659241-155659263 TATGCCAGATGCAGTTCTAGGGG + Intergenic
945625964 2:212206215-212206237 TGTGTCAGATCCTGTGCTAGGGG - Intronic
947452050 2:230217532-230217554 TGTGCCAGACTTTGTTCTAAGGG + Intronic
948243244 2:236456191-236456213 TGTGCCACATATTGTTCTAAGGG + Intronic
1168743326 20:213682-213704 TGTGCCAGAAACTGTCTTAGGGG - Intergenic
1169243814 20:4009066-4009088 TGTGCCACCTGCTGTCCTAGGGG + Intronic
1169332277 20:4725294-4725316 TGTGCCAGACGCTCTGCTAGGGG - Exonic
1172908097 20:38384550-38384572 TGTGCCAGGTGCTGTTCTAGGGG - Intergenic
1174409335 20:50323412-50323434 TGTGCCAGATGCTGTGCCAAGGG + Intergenic
1174620204 20:51868297-51868319 TGCTCCAGATTTTGTCCTAAAGG - Intergenic
1175189700 20:57202995-57203017 TGTGCCAGATACTGTCCCACGGG + Intronic
1178517791 21:33263458-33263480 TGAGTCAGATGTTGACCTTGGGG + Exonic
1178901917 21:36605398-36605420 TGAGCCAGATGATATCCTAAAGG - Intergenic
1179093031 21:38285645-38285667 TGTGCCAGATGTGGGCTGAGAGG + Intronic
1180996469 22:19968253-19968275 TGTGCCACATGCTGTTCTAAGGG + Intronic
1181059677 22:20276381-20276403 ACTGCCAGATGTGGTCCTGGTGG + Intronic
1182763229 22:32739684-32739706 TGTGCCTGATGTTATCCTTTTGG - Intronic
1182785068 22:32900471-32900493 TGTGCCAGGTGTTCTTCTAAGGG + Intronic
949577818 3:5355793-5355815 TATGCCAGATGTTATACTGGGGG - Intergenic
950758382 3:15197440-15197462 TGTGCCAGGTGTTGTGCTAAAGG + Intergenic
955882925 3:63566815-63566837 AGTGCCTGGTGTTGTTCTAGTGG - Intronic
956159127 3:66329996-66330018 TGTGCCAGATGCTGTTCTAGGGG + Intronic
958713062 3:97741506-97741528 TGTGCCAGTTGTGGTACTAGGGG + Intronic
959707617 3:109353242-109353264 TGTGCCAGATGTTATCCAGTTGG - Intergenic
961474325 3:127137254-127137276 TGTGGCAGATATTTCCCTAGCGG - Intergenic
963178794 3:142331325-142331347 TGTGCCAGATGTTATGCTATAGG + Intronic
963769299 3:149373151-149373173 TGTGTCAGATACTGTTCTAGCGG - Intronic
967200039 3:187064876-187064898 GGTGCCAGATGTTCTCCTTGTGG - Intronic
967342414 3:188414028-188414050 TGTGCCAGATACTCTTCTAGGGG + Intronic
967473261 3:189887563-189887585 TTTGCTAGATTTAGTCCTAGTGG - Intronic
967935793 3:194726380-194726402 TGTGCCAGACACTGTCCTGGGGG - Intergenic
968767475 4:2480611-2480633 TGTGCCAAGTGCTGTGCTAGTGG + Exonic
969918444 4:10513012-10513034 TGTGCCAGACAATGTGCTAGAGG - Intronic
970034622 4:11718960-11718982 TTTGCATAATGTTGTCCTAGAGG + Intergenic
970277496 4:14417426-14417448 TGTCCCAGATGTGGTTCCAGAGG + Intergenic
972454006 4:39234128-39234150 TCTGCCAGATACTGTTCTAGGGG - Intronic
973735632 4:53868997-53869019 TGTGCCAGGTGCTGTCCTGGGGG - Intronic
976551404 4:86399777-86399799 TGTGGCAAATGCTGTCCTAGTGG + Intronic
986487354 5:8250943-8250965 CCTGCCAGATGCTGTCCTAAGGG + Intergenic
986724569 5:10584680-10584702 TGTGCCAGGCGCTGTTCTAGGGG + Intronic
991300984 5:65128889-65128911 TGTGCCAGGTGTTGGCACAGAGG + Intergenic
991426226 5:66494838-66494860 TGTAGCAAATGTTATCCTAGAGG + Intergenic
993898602 5:93569908-93569930 TGCTCCAGATGTTGCACTAGAGG - Intergenic
995832650 5:116371027-116371049 TTTGCCAGATTTTGTTCCAGAGG + Intronic
996268952 5:121579094-121579116 AGTGCCAGAGGCTGTCATAGGGG + Intergenic
997787260 5:136724857-136724879 TGTGCCAGGTATTATTCTAGGGG + Intergenic
998146494 5:139731962-139731984 TGAGCCAGGTGTTCTGCTAGAGG + Intergenic
998389631 5:141779134-141779156 TGTGCCAAATGCTGTTCTACGGG - Intergenic
1000186467 5:158863353-158863375 TGTGACAGATGTGGTTCTGGAGG - Intronic
1001228420 5:169965061-169965083 TGTGCCACTTGCTGTGCTAGGGG + Intronic
1001327149 5:170737376-170737398 TGTGCCAGGTGCTGCACTAGGGG + Intergenic
1001605421 5:172956613-172956635 TGTGCCAGGTATTGTGCTAAGGG + Intergenic
1002771554 6:294328-294350 TGAGCCAGGTGTTGTGCTAGTGG + Intronic
1004159793 6:13203449-13203471 TGTGCCAGATACTGTTCTAAGGG - Intronic
1005136788 6:22578081-22578103 TGTGCCACATGCTCTTCTAGGGG + Intergenic
1005199099 6:23322984-23323006 TGTGCCCAAGGTTGTCTTAGTGG - Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1006840889 6:37027363-37027385 AGTGCCAGATGTTGGTCTGGGGG - Intronic
1006873173 6:37271941-37271963 CGTGCCACATGCTGTTCTAGAGG - Intronic
1007196851 6:40069158-40069180 TGTACTAGATGTTGTCATTGAGG + Intergenic
1007215275 6:40232518-40232540 TGTACAAGATTTTGTCCTAATGG + Intergenic
1007746677 6:44047485-44047507 TGTGCCAGGTGCTGTGCTTGGGG - Intergenic
1008055848 6:46945462-46945484 TGTGCCAGGTACTGTGCTAGGGG + Intronic
1009205544 6:60796757-60796779 TGTGCCAGGGGTAATCCTAGTGG + Intergenic
1010104786 6:72154847-72154869 TGTGCAAGATGCTGCCCTAGAGG + Intronic
1011728074 6:90230945-90230967 TGTGGAAGATGCTGTCCTTGTGG + Intronic
1013466333 6:110420180-110420202 TCTGCCAGATGTTATCAAAGTGG - Intergenic
1017164328 6:151392734-151392756 TGTGCCAGGCATTGTGCTAGTGG - Intergenic
1017448562 6:154531551-154531573 TTTGCCAGATGTTTTCTTGGGGG - Intergenic
1017920885 6:158870918-158870940 TGTTCTAGATCTTGACCTAGGGG - Intronic
1022878911 7:34565437-34565459 TGTGCAAGGTGCTTTCCTAGAGG + Intergenic
1023999757 7:45182664-45182686 TGTGCCAGGTGGTGGCCAAGTGG - Intronic
1024264526 7:47596644-47596666 TCTGCCAGTTGTTGGCCTACTGG - Intergenic
1026050122 7:66939591-66939613 TGTGCCAGCTACTGTTCTAGGGG + Intronic
1030346179 7:108435406-108435428 TGTGCTTGATGTTGTCCCATGGG - Intronic
1032131189 7:129229366-129229388 TGTGCCAGGAGTTGTCATAGGGG + Intronic
1038975319 8:32688995-32689017 TGGCCCAGATGTTTTCCAAGAGG + Intronic
1039227625 8:35405441-35405463 TGTGCCAGATTTTGACCAAATGG + Intronic
1042777674 8:72451919-72451941 TATGCCAGATCCTGTTCTAGGGG - Intergenic
1043116111 8:76255407-76255429 TGTACCAGATGTGGTGGTAGTGG - Intergenic
1043517511 8:81008765-81008787 TGTGCCAGCTGCAGTCCTGGAGG - Intronic
1045421390 8:102019536-102019558 TGGGCCAGATGTTTTCTTTGAGG - Intronic
1045797346 8:106061544-106061566 TGTAGCAGATGTTCTCCTACAGG - Intergenic
1046661408 8:116951538-116951560 TGTGGTAGATGCTGTCATAGGGG - Intronic
1046661453 8:116951946-116951968 TGTGGTAGATGCTGTCTTAGGGG + Intronic
1047014256 8:120706093-120706115 TGTGCTAGATGCTGTTCTAAGGG - Intronic
1047953114 8:129951916-129951938 TATGCCAGACATTGTTCTAGGGG - Intronic
1047978150 8:130152136-130152158 TGTGCCAAGTGATGTCCTTGGGG - Intronic
1048986981 8:139740006-139740028 TGTGCCAAATGGTGCACTAGGGG - Intronic
1049311016 8:141933919-141933941 TTTTCCAGATGATGTCCTGGAGG + Intergenic
1049311145 8:141934592-141934614 TGTCCTAGATGCTGTCCTTGTGG - Intergenic
1049766563 8:144357970-144357992 TGGGCCAGACGTGGTCCGAGCGG - Intronic
1049903955 9:198397-198419 TGTGCCAAATGTTCTCCAGGAGG + Intergenic
1052374685 9:27705798-27705820 TCTGACAGGTGTTGTCCTTGGGG - Intergenic
1053242530 9:36507690-36507712 AGTGCCAGATGTTGTTCTGCTGG + Intergenic
1054464736 9:65486939-65486961 TGTGCCAAGTTTTATCCTAGTGG + Intergenic
1054922839 9:70559174-70559196 TGTGCCAGGTAGTGTTCTAGAGG - Intronic
1055528368 9:77158151-77158173 TGTGCCAGAAACTGTTCTAGGGG - Intergenic
1055944518 9:81680859-81680881 TGTGTGAGATGTTGACTTAGGGG + Intronic
1056338543 9:85601495-85601517 TGTGCCAGCTGTGGTGGTAGTGG - Intronic
1058547295 9:106074151-106074173 TGTGCCAGACTCTGTTCTAGAGG - Intergenic
1059048778 9:110899946-110899968 ATTGCCAAATGTTTTCCTAGGGG + Intronic
1059611980 9:115908267-115908289 TGTGCCAGATACTGTCTCAGGGG + Intergenic
1059673821 9:116517146-116517168 TGTGTCAGCTGTGGTCCTATTGG - Intronic
1060925523 9:127452603-127452625 TGTGCCAGGTACTGTACTAGGGG + Intronic
1203691389 Un_GL000214v1:46158-46180 TTTGCAAGATGTTGCCCAAGGGG + Intergenic
1203644906 Un_KI270751v1:58033-58055 TTTGCAAGATGTTGCCCAAGGGG - Intergenic
1190444778 X:50513851-50513873 TGTGTAAGATGTTATCCTTGTGG + Intergenic
1192533301 X:71908199-71908221 TGTGCCAGATACTGTGCTAGAGG + Intergenic
1194715695 X:97284874-97284896 TGTGCCACATACTGTGCTAGGGG - Intronic
1198481344 X:137044290-137044312 TGTGTAAAATGTTGTCCAAGTGG + Intergenic
1199428391 X:147730351-147730373 TGTGCCAGGAATTGTTCTAGGGG + Intergenic
1199886037 X:152022853-152022875 TGTCACAGATGTTGCCCAAGTGG + Intergenic
1200420552 Y:2961216-2961238 TGTTGAAGATGTTGTCATAGAGG + Exonic