ID: 1162841508

View in Genome Browser
Species Human (GRCh38)
Location 19:13359729-13359751
Sequence GGTCCCATTGGGGCAGGTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 271}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162841502_1162841508 -5 Left 1162841502 19:13359711-13359733 CCAGTAGGGCTGACATTTGGTCC 0: 1
1: 0
2: 1
3: 1
4: 91
Right 1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG 0: 1
1: 0
2: 2
3: 20
4: 271
1162841498_1162841508 1 Left 1162841498 19:13359705-13359727 CCCTTCCCAGTAGGGCTGACATT 0: 1
1: 0
2: 2
3: 17
4: 159
Right 1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG 0: 1
1: 0
2: 2
3: 20
4: 271
1162841501_1162841508 -4 Left 1162841501 19:13359710-13359732 CCCAGTAGGGCTGACATTTGGTC 0: 1
1: 0
2: 2
3: 6
4: 83
Right 1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG 0: 1
1: 0
2: 2
3: 20
4: 271
1162841494_1162841508 13 Left 1162841494 19:13359693-13359715 CCCGTTGTTGGGCCCTTCCCAGT 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG 0: 1
1: 0
2: 2
3: 20
4: 271
1162841499_1162841508 0 Left 1162841499 19:13359706-13359728 CCTTCCCAGTAGGGCTGACATTT 0: 1
1: 0
2: 1
3: 23
4: 136
Right 1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG 0: 1
1: 0
2: 2
3: 20
4: 271
1162841495_1162841508 12 Left 1162841495 19:13359694-13359716 CCGTTGTTGGGCCCTTCCCAGTA 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG 0: 1
1: 0
2: 2
3: 20
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162841508 Original CRISPR GGTCCCATTGGGGCAGGTGC GGG Exonic
900090349 1:917602-917624 GGTCCCAGTGCTGCAGGTGTGGG + Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900374491 1:2347212-2347234 CGTCCCCTTGGGGCAGCTGGTGG + Intronic
900406864 1:2496591-2496613 GGTCGCCCTGTGGCAGGTGCAGG - Exonic
900957979 1:5899481-5899503 GGTTCCCTTGGGGGAGGTGAAGG + Intronic
900973839 1:6005752-6005774 CCTCCCATTGGGGCAGATGGGGG + Intronic
901079223 1:6574465-6574487 GGCTCCACTGGGGCAGGTTCTGG - Intronic
901796791 1:11684160-11684182 GGTTCCATGGGGGCGGGGGCAGG + Intronic
902292451 1:15444423-15444445 GGTCCCAGAGGGTCAGGAGCAGG - Intronic
902437862 1:16409721-16409743 GCTCCCATGGGGGCAGGTTCTGG + Exonic
902461852 1:16583564-16583586 GACCCCATGGGGGCAGGTGGGGG - Intronic
903032238 1:20472282-20472304 GTTCCCTCTTGGGCAGGTGCTGG - Intergenic
903225973 1:21894447-21894469 GCTGCCCTTGGGGCAGGTCCAGG - Intronic
903651901 1:24927706-24927728 GGTGGCATTGGGGGACGTGCCGG - Exonic
904703664 1:32374671-32374693 GGTGAGTTTGGGGCAGGTGCAGG - Intronic
905004144 1:34696817-34696839 GCTCCCATTGGACCCGGTGCTGG - Intergenic
906510447 1:46407668-46407690 GTCCCCAGTGAGGCAGGTGCTGG + Intronic
906709221 1:47916674-47916696 GGGCCCATTAGGGAAGCTGCAGG + Intronic
907306303 1:53514924-53514946 GGCCCCAGTGAGGGAGGTGCTGG + Intronic
907308753 1:53527701-53527723 GGGCCTCTGGGGGCAGGTGCTGG + Intronic
907509258 1:54946205-54946227 GGACCCACTGGGGCAGGCACGGG - Intergenic
908661124 1:66436512-66436534 GCTCCCCTTGTGGTAGGTGCTGG + Intergenic
911673952 1:100638028-100638050 GGACCCTCTGTGGCAGGTGCGGG + Intergenic
912636190 1:111295910-111295932 GGACCCACTGAGCCAGGTGCGGG - Intronic
920525632 1:206663949-206663971 GGTGCCGTGGGAGCAGGTGCTGG + Intronic
920944403 1:210515024-210515046 AGGCCCTTTTGGGCAGGTGCTGG + Intronic
921342043 1:214143886-214143908 GGGCCCATGGGGGCAAGTGATGG + Intergenic
923772367 1:236948704-236948726 AGTCCCTGTGGAGCAGGTGCTGG - Intergenic
924657175 1:245983458-245983480 GGTCCCAGGGGGCCACGTGCTGG - Intronic
1062815918 10:499945-499967 AGTCCCATTGTGGCAGGGTCAGG - Intronic
1063381796 10:5590451-5590473 GGTCTCTTTGGAGCAGGTTCGGG - Intergenic
1066746234 10:38605478-38605500 GGTCTCTCTCGGGCAGGTGCTGG - Intergenic
1067193345 10:44091241-44091263 GGACCCACTGAGCCAGGTGCAGG - Intergenic
1068729082 10:60336125-60336147 AGTCACATTGGGGCAGGTTGGGG + Intronic
1069059594 10:63881938-63881960 GGTCCCATGGTGGATGGTGCTGG + Intergenic
1069707396 10:70467394-70467416 GGTCCCAGTGGTGGAGGTGGGGG + Intergenic
1069858818 10:71457554-71457576 GGTCCACATGGGGCAGGTGCTGG + Intronic
1071088796 10:81895420-81895442 GGTTCCCTTTGGGCAGGGGCGGG - Intronic
1074134325 10:110613709-110613731 AGACACATTAGGGCAGGTGCAGG + Intergenic
1074198661 10:111211430-111211452 GATCCCAAAGGTGCAGGTGCAGG - Intergenic
1074451043 10:113559934-113559956 GGACACATTGGGGCAGGGGAGGG - Intronic
1076294708 10:129375475-129375497 GGTGCCCTTGGAGCAGGGGCTGG + Intergenic
1076434029 10:130427345-130427367 GGTGCCTTTGGAGCAGGTGGAGG + Intergenic
1076743040 10:132497546-132497568 GGGCCCCTTGGGGCTGGTGTTGG - Intergenic
1077144786 11:1040031-1040053 GGGCCCAGCGGGGCAGGGGCAGG - Intergenic
1077417656 11:2432374-2432396 GGCCCCGTGGGGGCAGGGGCTGG - Intergenic
1079081370 11:17415592-17415614 GGTGCCATTGGTGCAGGCTCTGG + Intronic
1079156697 11:17954665-17954687 AGTGCCATTGGAGCAGGAGCAGG - Intronic
1079549335 11:21674708-21674730 GGTCCCCTCGAGCCAGGTGCGGG + Intergenic
1080346862 11:31335195-31335217 GGACCCACTGAAGCAGGTGCGGG + Intronic
1080853535 11:36091878-36091900 GGTCCCATGGGGCCTGGTCCAGG - Intronic
1081600370 11:44488536-44488558 GGTGCCACTGGGGCTGGTGCTGG - Intergenic
1081751288 11:45512994-45513016 GGTGACATTGGAACAGGTGCTGG - Intergenic
1083176680 11:60954516-60954538 GGTACCAGGGGGCCAGGTGCTGG + Intergenic
1084430634 11:69108878-69108900 GCTCCCAAAGGGGCAGGGGCAGG - Intergenic
1084463211 11:69307704-69307726 GGTCCCTTGGGGGGAGGTTCTGG + Intronic
1085533172 11:77203472-77203494 GGTCCCATGAGGCCAGGGGCTGG - Intronic
1086753539 11:90529738-90529760 GGCCACAGTGGGGCAGGGGCAGG - Intergenic
1088588355 11:111379491-111379513 GGTCCCCGCGGGGCCGGTGCAGG - Exonic
1091997147 12:5002541-5002563 GGTCCCATGGGGGGAACTGCAGG + Intergenic
1094761515 12:33538419-33538441 TGTCCCATTGGTCCAGATGCAGG + Intergenic
1095986814 12:48004623-48004645 GGTCCGGCTTGGGCAGGTGCGGG - Intergenic
1098886829 12:75969015-75969037 GAGCCCATAGGGGCAAGTGCTGG - Intergenic
1099923620 12:88990102-88990124 GGTCCTGTTGGGGAAGGTGTGGG + Intergenic
1100392614 12:94157159-94157181 GTAACCCTTGGGGCAGGTGCTGG + Intronic
1101970288 12:109308041-109308063 GGTCCCACTGGGCCAGGTTGTGG + Intronic
1102001876 12:109562501-109562523 GCTCCCATGGGGGCAGCAGCTGG + Intronic
1104276640 12:127334566-127334588 GGTGCCATTGGTACAGGTGCTGG + Intergenic
1106289161 13:28344485-28344507 GGTGACAGTGGGGCAGATGCTGG - Intronic
1106457000 13:29936250-29936272 GGGCCCACCTGGGCAGGTGCGGG + Intergenic
1109319287 13:60790111-60790133 GGTTGCAATGGAGCAGGTGCTGG + Intergenic
1113848917 13:113407096-113407118 GGTCCCAGTGGGGATGATGCAGG + Intergenic
1119557423 14:75564465-75564487 GGCTCCATGAGGGCAGGTGCTGG - Intergenic
1121614923 14:95307329-95307351 AGTCCTACTGGGTCAGGTGCTGG - Intronic
1122569037 14:102681776-102681798 GGGCCCATTGGGCCAGATACAGG + Intronic
1122652769 14:103234655-103234677 GGTAACAATGGGGCAGGTGTGGG + Intergenic
1124724679 15:32145715-32145737 GGTCCCACTGGGCCAGGCACAGG + Intronic
1127966392 15:63925805-63925827 GGTCTAATCCGGGCAGGTGCTGG - Intronic
1129031004 15:72617673-72617695 GGTCCCAATGGGGCACATGTGGG + Intergenic
1130316471 15:82800991-82801013 GGTTACATTGGGGCAGGTGTAGG - Intronic
1130738340 15:86572466-86572488 GGCCCCATCGTGGCAGTTGCCGG + Intronic
1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG + Intronic
1131529656 15:93180515-93180537 GTCCCCACTGGGGCAGGCGCTGG + Intergenic
1132516536 16:368646-368668 GCTCACATGGGGCCAGGTGCTGG + Intronic
1133310777 16:4845497-4845519 GGTCACATTGGAGCAGGGGTGGG - Intronic
1136379950 16:29888577-29888599 GGTGCCATTGAGGCAGATGAGGG + Exonic
1137667326 16:50259359-50259381 GGTCACACTGGGCCGGGTGCAGG + Intronic
1138535169 16:57656110-57656132 GGTCCAAATGGGGCGGGTGGTGG + Intronic
1139491763 16:67289754-67289776 TCTCCCATTGGGGCAGGGACAGG + Intronic
1140524703 16:75612908-75612930 GATCCCATTGTGGCTGGTCCAGG - Intronic
1141763730 16:86045362-86045384 GTTCCCATTGGAGCAGGGCCAGG + Intergenic
1141984779 16:87572685-87572707 GGTCCCACAGGTGCAGGTGCTGG + Intergenic
1142317957 16:89361062-89361084 GGTGCCATTGCAGCAGGGGCTGG - Intronic
1142803078 17:2357108-2357130 GGTCACATCGGGGCTGGTGAAGG + Intronic
1143089344 17:4439804-4439826 GGACCCAGTGGGGCTGGAGCTGG - Intronic
1143625907 17:8110051-8110073 GGGCCCAGCGGGGCAGGGGCCGG - Intronic
1143738300 17:8930861-8930883 GTTAGCATTAGGGCAGGTGCAGG + Intronic
1143972044 17:10803077-10803099 TATCCCATCTGGGCAGGTGCAGG + Intergenic
1145036025 17:19541241-19541263 GGGCCCCATGGGGCAGATGCAGG + Intronic
1146576826 17:34001444-34001466 GGGTCCAGTGGGGCTGGTGCTGG + Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147505167 17:41008955-41008977 GATCTCATGTGGGCAGGTGCTGG + Exonic
1147562803 17:41519440-41519462 GGGCCCCTGGGGGCAGGTGGAGG + Exonic
1148773271 17:50079078-50079100 GGGCCCAATGGGGGAGGGGCTGG + Exonic
1151308715 17:73280405-73280427 GGACCCGCTGGGGCAGGTGGCGG + Intergenic
1151867696 17:76815301-76815323 GGTCCCATGTGGGCATCTGCAGG + Intergenic
1152037120 17:77880363-77880385 GGTCCCAGCAGGGCAGGTTCAGG + Intergenic
1152093477 17:78259163-78259185 GGTCCCAGTTGGGGAAGTGCAGG - Intergenic
1152756740 17:82090197-82090219 GGGGCCAGTGGGGCAGCTGCAGG + Intronic
1153247471 18:3087349-3087371 GATCCACTTTGGGCAGGTGCAGG - Intronic
1153379823 18:4425799-4425821 GGTCATATTGGGGGAGTTGCAGG - Intronic
1157721280 18:49926467-49926489 GGTCCCAGTGGGACAGGCTCTGG + Intronic
1158674474 18:59505952-59505974 GGAACCATGGCGGCAGGTGCAGG + Intronic
1161265448 19:3361412-3361434 GGTCCATTGGGGGCAAGTGCTGG - Intronic
1161304114 19:3557470-3557492 GGTGCCGTGGGGGCAGGCGCCGG + Exonic
1162013546 19:7831548-7831570 GTTCCCACAGGGGTAGGTGCTGG - Intronic
1162128480 19:8511736-8511758 GGTCCGGTGGGGGCAGGGGCGGG + Exonic
1162137645 19:8565605-8565627 GGGCCTAGTGGGGCAGGAGCAGG + Intronic
1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG + Exonic
1163617940 19:18340785-18340807 GGGCCGAGAGGGGCAGGTGCTGG + Intronic
1163692971 19:18747054-18747076 GGTGCCATAGGGGCAGCTGTCGG - Exonic
1165094054 19:33401050-33401072 GGTACCAGTGGGGCCTGTGCAGG + Intronic
1165460361 19:35940453-35940475 CGTCCCATTGGGGAAGGCGCGGG - Exonic
1166118035 19:40667618-40667640 GGCCCCATTGGGGCGAGGGCGGG + Exonic
1167002190 19:46752388-46752410 GCTCCCATTAGTGCAGGGGCAGG - Intronic
1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG + Intronic
1167557509 19:50205394-50205416 GTTCCCAGCCGGGCAGGTGCTGG + Intronic
1168254199 19:55157096-55157118 CGTCTGATTGGGGCTGGTGCAGG + Exonic
1168312001 19:55465114-55465136 GCTCCCAAAGGGGCTGGTGCGGG + Intergenic
1168336934 19:55602301-55602323 GCCCCCACTGGTGCAGGTGCAGG + Exonic
925173436 2:1766765-1766787 GCTCCCAGAGGAGCAGGTGCAGG + Intergenic
928167227 2:28980179-28980201 GGTCCCTCTGGGGCAGGTGCTGG - Intronic
928407264 2:31024185-31024207 GGTGACAGTGGTGCAGGTGCTGG - Intronic
930013725 2:46956794-46956816 GGTAACTTTGGGGCAGGCGCTGG + Intronic
932039483 2:68284077-68284099 GGTCCCGTGGGGGCAGGAGATGG - Intergenic
933946609 2:87291755-87291777 ACTCCCAGTGGGGCAGTTGCTGG + Intergenic
934977652 2:98816027-98816049 TGTCCCATAGGGGCTGGTGGTGG + Intronic
934985265 2:98880747-98880769 GGACCCATTGGGGCAAGTCTGGG - Intronic
935731091 2:106065528-106065550 GTTCCCCTTGGGGCCGGGGCGGG + Intronic
936333583 2:111569786-111569808 ACTCCCAGTGGGGCAGTTGCTGG - Intergenic
937929302 2:127192168-127192190 AGTCCCACAGTGGCAGGTGCAGG - Intronic
938730010 2:134140099-134140121 CAACCCAGTGGGGCAGGTGCAGG - Intronic
938783521 2:134606220-134606242 GGATTCATGGGGGCAGGTGCTGG - Intronic
940059654 2:149550863-149550885 GGACCCTTTGGGCCATGTGCGGG + Intergenic
941757435 2:169202832-169202854 GCGCCCATTGGAGCAGGTGAAGG + Exonic
947138083 2:226994969-226994991 GGCCACATTGGGGCAGGAGGCGG + Intronic
947691560 2:232141626-232141648 GGTTCCATTGGAGCAGATGACGG + Intronic
948143311 2:235690343-235690365 CGTGCCCTGGGGGCAGGTGCAGG + Intronic
948764776 2:240213699-240213721 GGCTCCATGGGGCCAGGTGCTGG - Intergenic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
948910795 2:241001677-241001699 GGTTTCCTAGGGGCAGGTGCAGG + Intronic
1169340884 20:4795433-4795455 GGTCCCAGTGGGGAGGGTGCTGG + Intronic
1171786666 20:29471935-29471957 GGACCCTCTGGGCCAGGTGCGGG + Intergenic
1173138999 20:40465516-40465538 TGTCCCATTGGGGGAGGATCAGG - Intergenic
1173147290 20:40535663-40535685 ATTCCCACTGGGGCAGGTGCAGG + Intergenic
1173248781 20:41353710-41353732 GCTCCCAGAGGGGCAGGTGCAGG - Intronic
1173555118 20:43960486-43960508 GCTCCCCTTGGGACAGGTGGAGG + Intronic
1173894618 20:46541579-46541601 GATCCCCTAGGGGCAGCTGCTGG + Exonic
1174373766 20:50112314-50112336 GGTCCGAGTGGGGCAGTTGGTGG - Intronic
1175701084 20:61137607-61137629 GGTCCTGTTGGGGAAGGAGCCGG - Intergenic
1175875684 20:62228199-62228221 GCACCCATAGGGGAAGGTGCCGG - Intergenic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1176155686 20:63619229-63619251 GGTGCCATTGGGGCTGATGGGGG - Intronic
1176257191 20:64158660-64158682 GGGACCAGTGGGGCAGGTGGGGG - Intronic
1179893522 21:44349636-44349658 GTCCCCATCGCGGCAGGTGCTGG - Intergenic
1179979557 21:44889023-44889045 GGCCCAAGTGGGGCAGATGCGGG + Intronic
1180236132 21:46459811-46459833 GATCCCATTGGGGGAGCAGCTGG - Intronic
1181570099 22:23763779-23763801 GGTCCCGTGGGGGCGGGTCCCGG + Intronic
1181610896 22:24011271-24011293 GCTCCCATTGGCTCCGGTGCCGG - Intronic
1182419295 22:30241179-30241201 GGTCCCATGGGGCCAAGTCCAGG + Exonic
1183452767 22:37905958-37905980 GGTCCGCTTGCGGCGGGTGCGGG + Intronic
1184271828 22:43388745-43388767 GGTCTGGCTGGGGCAGGTGCTGG + Intergenic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1184872177 22:47247786-47247808 GGTCCCACCAGGGCAGGTCCAGG + Intergenic
950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG + Intergenic
950742768 3:15063420-15063442 GGTCCCAGTGGGGCAGCTGAAGG + Intronic
951262172 3:20523331-20523353 GCCCCCACTGGAGCAGGTGCTGG - Intergenic
951501145 3:23389094-23389116 GGTCCCACAGGGGCAGTGGCAGG + Intronic
953992668 3:47496236-47496258 GTTCCCAGTGGAGCAGGTCCTGG - Intronic
954028647 3:47802927-47802949 CGCCCCATTGGGCCGGGTGCTGG + Exonic
954571924 3:51648146-51648168 GGACCCACTGAGACAGGTGCGGG - Intronic
954713574 3:52516459-52516481 GGTCCCAATGGGGAGGGGGCAGG + Intronic
954852674 3:53616865-53616887 GTTTCCATGGAGGCAGGTGCAGG + Intronic
954861593 3:53695168-53695190 GGTCCCCGTGGAGGAGGTGCTGG + Intronic
956952645 3:74299773-74299795 GGTGCCAATGGTGCAGGTGGTGG - Intronic
959308278 3:104696768-104696790 GGACCCAGTGAGCCAGGTGCGGG + Intergenic
960622292 3:119648433-119648455 GGTCCCACTGCTGCAGATGCTGG - Exonic
961379560 3:126488126-126488148 GGTTCCTTTGGGGCAGGGCCAGG - Intronic
963984446 3:151575518-151575540 GGACCCACTGAGCCAGGTGCAGG + Intergenic
965638725 3:170811166-170811188 CCTGCCATTGGGGCAGGTGTTGG - Intronic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
968650163 4:1757254-1757276 GGGCCCCTTGAGGCAGGTGTGGG + Intergenic
969662867 4:8540570-8540592 GGTTCCGGTGGGGCAGGGGCGGG + Intergenic
972756752 4:42055804-42055826 GGTACCATTTATGCAGGTGCTGG + Intronic
974104436 4:57453817-57453839 GGACCAATTATGGCAGGTGCAGG + Intergenic
980480447 4:133380273-133380295 GCTCACAGAGGGGCAGGTGCGGG - Intergenic
981271415 4:142850560-142850582 GGACTCATTGGAGCAGGAGCTGG - Intergenic
981449733 4:144882724-144882746 AGTCCCATTGGGAAAGGTGAAGG - Intergenic
983334533 4:166375057-166375079 GGACCCACTGAGCCAGGTGCAGG + Intergenic
984903914 4:184609521-184609543 GACCCCATTGGGGCAGTTGCAGG + Intergenic
985033293 4:185813733-185813755 GGTCCATTTGGGCCAGGTGTTGG - Intronic
985794765 5:1953759-1953781 GGACCCACTGAGCCAGGTGCAGG - Intergenic
985949913 5:3215223-3215245 GGTCACACTTTGGCAGGTGCTGG - Intergenic
986551366 5:8959538-8959560 GGTCTCACTGGGGTAGGGGCAGG - Intergenic
988830905 5:34986420-34986442 GGTCCCACTGTGGCAGGTCTTGG + Intergenic
989166569 5:38438369-38438391 GTGCCCATGGGGGCAGCTGCCGG + Exonic
989345298 5:40423005-40423027 GGACCCACTGAGCCAGGTGCAGG + Intergenic
989817209 5:45750873-45750895 AGTCCCATTGGGGCAGTGCCTGG - Intergenic
990488449 5:56281136-56281158 GGGCCCACTGGAGCAGGAGCTGG - Intergenic
994224843 5:97240067-97240089 GGACCCTCTGGGGCATGTGCAGG + Intergenic
994290392 5:98022936-98022958 GGACCCTCTGAGGCAGGTGCAGG - Intergenic
995340331 5:111051261-111051283 GGTCTCTTTGGTGCAGTTGCAGG - Intergenic
998009664 5:138684465-138684487 GGACCCTCTGAGGCAGGTGCGGG + Intronic
998250974 5:140552142-140552164 GGCCCCATTGGGGGAGGCCCAGG + Exonic
999699024 5:154211190-154211212 GGTCCCTTTGGGGAACTTGCAGG + Intronic
1000041212 5:157486480-157486502 AGTCCCAGGGGTGCAGGTGCAGG + Intronic
1000171610 5:158707989-158708011 GTTCCCGTTGGTGCTGGTGCAGG + Exonic
1000380979 5:160629144-160629166 GGTGCCAGATGGGCAGGTGCAGG + Intronic
1004360719 6:14968345-14968367 AGTCCCATTGCTGCAGGAGCTGG + Intergenic
1006728091 6:36214448-36214470 TGGCCAATTGGGGAAGGTGCTGG - Intronic
1007247501 6:40472990-40473012 GGTCTCATTGGGCGAGATGCTGG + Intronic
1009413418 6:63392388-63392410 GGTCCCTTTGGAGCTGGAGCTGG - Intergenic
1011089514 6:83580524-83580546 GGTACCATTGAGACAGGTGCAGG + Exonic
1011623692 6:89266394-89266416 AGTGCCACTGGGGCAGGAGCTGG + Intronic
1011909696 6:92421083-92421105 GGACCCACTGAGCCAGGTGCGGG - Intergenic
1013367467 6:109446734-109446756 GGTCTGTCTGGGGCAGGTGCTGG + Exonic
1017044938 6:150338181-150338203 GGTCCCATTGGGGCAGGATGAGG + Intergenic
1017121724 6:151030304-151030326 GGCCACACTGGGGTAGGTGCAGG + Intronic
1017240273 6:152160414-152160436 GCTCCCATCTGGACAGGTGCTGG + Intronic
1018920251 6:168167608-168167630 GGTGCGCTGGGGGCAGGTGCAGG + Intergenic
1019154371 6:170029337-170029359 GGTCACTTTGGGGTTGGTGCAGG - Intergenic
1019407015 7:889200-889222 CCTCCCACTGGGGTAGGTGCGGG + Intronic
1019580703 7:1760658-1760680 GGTCCCATAGCTGCAGGTGGCGG - Intergenic
1021522867 7:21554461-21554483 GATCCCAAGGGGCCAGGTGCAGG - Intronic
1022794660 7:33722537-33722559 GGTCACACTGGGGCAGCAGCAGG - Intergenic
1023502526 7:40865650-40865672 AGTTCCATTAGGGCAGGAGCAGG + Intergenic
1023865019 7:44234408-44234430 CGTCCCTTTGGGGCTGGTGGCGG + Exonic
1024736233 7:52307823-52307845 GGCCCCATGAGGGCAGGTGAGGG + Intergenic
1025617152 7:63130664-63130686 GGGCTCATGGGGGCAGGGGCAGG - Intergenic
1029202896 7:98850953-98850975 GCTGGCATTGGGGCAGGTGGTGG + Intronic
1029211062 7:98908773-98908795 GGTCGCTGAGGGGCAGGTGCTGG - Exonic
1030386690 7:108875110-108875132 GGTCCCTCTGGTGCAGCTGCAGG - Intergenic
1031700573 7:124919887-124919909 AGTCCCATGGGGGCAGGGACAGG - Intronic
1031796839 7:126185915-126185937 ACTTCCACTGGGGCAGGTGCTGG - Intergenic
1032402436 7:131633199-131633221 GGGCCCCTTGGGCCAGGGGCTGG + Intergenic
1035567056 8:648388-648410 GGTCGCAGTAGGGGAGGTGCTGG + Intronic
1036367718 8:8135560-8135582 GGTCTAATTTGGGGAGGTGCAGG + Intergenic
1036661587 8:10712718-10712740 GACCCCATTGGGACAGGTCCTGG - Intergenic
1036883163 8:12530101-12530123 GGTCTAATTTGGGGAGGTGCAGG - Intergenic
1036979940 8:13459564-13459586 GTTCCAATGGGGGCAGGGGCTGG + Intronic
1036999944 8:13705895-13705917 GGTGCCATAGGTGCAGCTGCTGG + Intergenic
1038179900 8:25217677-25217699 GGTCCCCTTCTTGCAGGTGCTGG - Intronic
1038478498 8:27885553-27885575 GGACCCAGATGGGCAGGTGCTGG + Intronic
1040292678 8:46133416-46133438 GGACCCATTGAGGCAGGTAGAGG - Intergenic
1040934330 8:52767047-52767069 GGTCCCATCGGGGCAGGGCGAGG + Intergenic
1044458407 8:92416007-92416029 GTTCTCATTCGGGCAGGGGCGGG - Intergenic
1044496821 8:92896618-92896640 GGTCACATTGGGGCAGGCATTGG - Intronic
1047807271 8:128373522-128373544 GGTGCCAGTGGTGCTGGTGCTGG + Intergenic
1048878242 8:138853249-138853271 GGCCCCATTGGAGCAGGTTCAGG + Intronic
1049164608 8:141118184-141118206 GGCCCCAGTGGTGTAGGTGCCGG - Intronic
1049221899 8:141432218-141432240 GGAGCGACTGGGGCAGGTGCTGG + Exonic
1051604230 9:18905014-18905036 GGTTCCACTGGGGGTGGTGCTGG - Intronic
1053288403 9:36864582-36864604 GGGCCGATGGGGGCAGGTGAGGG - Intronic
1053508337 9:38665840-38665862 TGTACCTTTGGGCCAGGTGCGGG - Intergenic
1056002497 9:82231477-82231499 GGCTCCATGGTGGCAGGTGCTGG - Intergenic
1057310498 9:93940137-93940159 GGTCCCATTGTGTCTGGAGCTGG - Intergenic
1057883302 9:98808947-98808969 GTTCCCATTGGAGCTGGTGGTGG + Intronic
1061412143 9:130427566-130427588 GAAGCCAGTGGGGCAGGTGCAGG - Exonic
1061582303 9:131545640-131545662 GGTGCCGGAGGGGCAGGTGCTGG + Intergenic
1062414324 9:136439979-136440001 GGTCCCAGCGAGGCAGGTGCAGG + Intergenic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1190016624 X:46832987-46833009 GGTCCCATTGCTGCAGCTGCAGG - Intergenic
1190296336 X:49029956-49029978 GGTTCCTTTGGGGAAGGTGCAGG + Exonic
1190737743 X:53266869-53266891 GGTCCCATGGGGGAATCTGCGGG + Intronic
1191092188 X:56635367-56635389 GGACCCTCTGGGCCAGGTGCAGG + Intergenic
1191255431 X:58277609-58277631 GACCCCACTGGGTCAGGTGCAGG + Intergenic
1192491186 X:71578697-71578719 GGTAGCATTGGGGGAGGTGGGGG + Intronic
1193647993 X:84092028-84092050 GGTCCTGTTGGGGGAGGGGCAGG + Intronic
1196632580 X:117960263-117960285 GCTCCTATTATGGCAGGTGCAGG - Intronic
1196951041 X:120875631-120875653 GGTCCCCTTGGGTCGGGTGTCGG + Exonic
1196951872 X:120932003-120932025 GGTCCCCTTGGGTCGGGTGTCGG + Exonic
1196952556 X:120936864-120936886 GGTCCCCTTGGGTCGGGTGTCGG + Exonic
1196953241 X:120941725-120941747 GGTCCCCTTGGGTCGGGTGTCGG + Exonic
1196953926 X:120946585-120946607 GGTCCCCTTGGGTCGGGTGTCGG + Exonic
1196954611 X:120951446-120951468 GGTCCCCTTGGGTCGGGTGTCGG + Exonic
1196955294 X:120956306-120956328 GGTCCCCTTGGGTCGGGTGTCGG + Exonic
1196955981 X:120961189-120961211 GGTCCCCTTGGGTCGGGTGTCGG + Exonic
1196956663 X:120966050-120966072 GGTCCCCTTGGGTCGGGTGTCGG + Exonic
1196957345 X:120970910-120970932 GGTCCCCTTGGGTCGGGTGTCGG + Exonic
1196958027 X:120975770-120975792 GGTCCCCTTGGGTCGGGTGTCGG + Exonic
1196958709 X:120980630-120980652 GGTCCCCTTGGGTCGGGTGTCGG + Exonic
1196959390 X:120985490-120985512 GGTCCCCTTGGGTCGGGTGTCGG + Exonic
1202344392 Y:23906157-23906179 GGTCCCTTTGAGCCAGGTGTGGG + Intergenic
1202526376 Y:25763926-25763948 GGTCCCTTTGAGCCAGGTGTGGG - Intergenic