ID: 1162842862

View in Genome Browser
Species Human (GRCh38)
Location 19:13369070-13369092
Sequence GGGTGCTAACAGATGCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162842859_1162842862 16 Left 1162842859 19:13369031-13369053 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1162842862 19:13369070-13369092 GGGTGCTAACAGATGCAGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162842862 Original CRISPR GGGTGCTAACAGATGCAGTG TGG Intronic
902372925 1:16016878-16016900 CGGTGCAAAGAGAGGCAGTGAGG + Intronic
902547674 1:17200071-17200093 GGGTGGTAACTGCTGCAGAGGGG - Intergenic
904918280 1:33985965-33985987 GGGTGCTAACTGATGCTCAGGGG - Intronic
910984570 1:92993036-92993058 TGGTGGCAAAAGATGCAGTGAGG - Intergenic
911306101 1:96234355-96234377 TGGTGCTCAGAGATGAAGTGGGG - Intergenic
912977067 1:114340575-114340597 GGGGGCTAACTGATGAAGTCTGG + Intergenic
920351140 1:205338843-205338865 GGAGGCTAATAGAGGCAGTGAGG + Intronic
922041734 1:221904009-221904031 GGGTGCTAACAAGCTCAGTGGGG - Intergenic
1063800449 10:9571672-9571694 AGGTGAGAAAAGATGCAGTGTGG - Intergenic
1069232525 10:66029314-66029336 GGGTGGGGACAGATCCAGTGAGG - Intronic
1069746742 10:70719916-70719938 GTGTGTAAACAGAGGCAGTGTGG - Intronic
1070809584 10:79290908-79290930 AGGTGCTACCCGAGGCAGTGTGG - Intronic
1074787730 10:116855789-116855811 TGTTGCTAATAAATGCAGTGGGG - Intronic
1075474371 10:122720830-122720852 GGGTGCAAACACATGTAGTTGGG + Intergenic
1079237354 11:18699941-18699963 GGCTGCTAACAGATCCATTGAGG - Intronic
1080807433 11:35666982-35667004 GGGTGCTATCCAATGCAGTAAGG - Intronic
1082139254 11:48588341-48588363 GGGTTGTAGCAGAGGCAGTGTGG + Intergenic
1084461469 11:69298883-69298905 GGGTCCTGACAGAGGCCGTGGGG - Intronic
1085385186 11:76153464-76153486 AGGTGTGAACAGCTGCAGTGGGG - Intergenic
1086452849 11:86934214-86934236 GTGTGCTGAAAGAAGCAGTGGGG - Intronic
1087831453 11:102823610-102823632 GGGTGGTGACAGTTGCAGTAGGG - Intergenic
1089499251 11:118922976-118922998 GTGTGGTACCAGAGGCAGTGTGG + Intronic
1092360372 12:7831553-7831575 GGGCTCTACCAGATGCATTGGGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093116467 12:15217951-15217973 GTGTACAAACACATGCAGTGGGG + Intronic
1093145615 12:15562583-15562605 GGGTGGTAGCAGAATCAGTGTGG + Intronic
1096996848 12:55843522-55843544 GGGAGCTTACGGATCCAGTGAGG + Intergenic
1100317717 12:93460878-93460900 GGGTGCTAGCAAAAGCAATGAGG - Intergenic
1100853613 12:98739067-98739089 GTGTGCAAACAGATGCAGAGAGG + Intronic
1102688471 12:114742264-114742286 GGGTGCTTTGAGCTGCAGTGGGG + Intergenic
1106537121 13:30656142-30656164 AGGTGCTAACAGGTGGTGTGGGG - Intronic
1108662449 13:52599545-52599567 GGGTACTAACAGATTCACTCAGG + Intergenic
1112555397 13:100463477-100463499 AGGTGATAACTGATGCAGTTAGG + Intronic
1118939857 14:70323698-70323720 TGGTGGTAATACATGCAGTGGGG + Intergenic
1120221204 14:81736124-81736146 GGGTACTAACTTATGCACTGAGG + Intergenic
1121218125 14:92264272-92264294 GGGTGCTATCTGAGGCAGAGAGG + Intergenic
1121379834 14:93454454-93454476 GTGTGCTAAAATGTGCAGTGGGG + Intronic
1122848145 14:104512031-104512053 AGGTGCTCACAGGTGCACTGCGG - Intronic
1124142051 15:27086267-27086289 GGCTGCTCACAGATGAAGGGGGG - Intronic
1124177490 15:27439935-27439957 GAGGTCTAACACATGCAGTGAGG - Intronic
1124413474 15:29455768-29455790 AGGTGGTAACACAAGCAGTGGGG - Intronic
1125406097 15:39353846-39353868 TGGGGCTAACAGATGCAGCCAGG - Intergenic
1125575827 15:40754982-40755004 GGGTGAGAAGAGAGGCAGTGGGG - Exonic
1125884855 15:43220976-43220998 GGGTGCTCACAGGAGTAGTGGGG - Exonic
1127662087 15:61109470-61109492 ATGTGATAACAGAGGCAGTGAGG - Intronic
1128533055 15:68468345-68468367 TGGTGCAATAAGATGCAGTGAGG + Intergenic
1128818252 15:70629885-70629907 GGGTGCTGACAGAGGCAGGGAGG - Intergenic
1132689488 16:1176178-1176200 GTGTGGTTACAGATGCTGTGTGG + Intronic
1135783032 16:25323122-25323144 AGGCACTAACAGGTGCAGTGAGG + Intergenic
1137898226 16:52237359-52237381 TGGTGCTAACTGAGTCAGTGGGG + Intergenic
1141932720 16:87216781-87216803 GGGGGCTGACAGATGCCGCGAGG - Intronic
1142677202 17:1521157-1521179 GGGTGCTAACAAAAGCTGTCTGG + Intronic
1143273066 17:5689840-5689862 GGATGGAAACAGATGCAGAGAGG - Intergenic
1143560760 17:7693066-7693088 TGCTGCTAAGAGATGCAGTGAGG - Intronic
1152322276 17:79614311-79614333 GGATGCTGACAGGTGCCGTGAGG - Intergenic
1155373703 18:25133287-25133309 GGGAGCAAACAGAAGTAGTGAGG - Intronic
1156098717 18:33566867-33566889 TGATGTTAACACATGCAGTGTGG + Intergenic
1156384421 18:36592837-36592859 AGATGCTAACAGATTCACTGTGG - Intronic
1157602166 18:48900917-48900939 GGGTGCTAAGAGAAGCAAGGAGG - Intergenic
1159384321 18:67703790-67703812 GGGTGGTGACAGAGGGAGTGGGG - Intergenic
1162842862 19:13369070-13369092 GGGTGCTAACAGATGCAGTGTGG + Intronic
1164426996 19:28150423-28150445 GGGTGTTAACAGGAACAGTGGGG - Intergenic
1166898604 19:46040497-46040519 AGGTGAGAACAGATGCAGTGAGG - Exonic
1168102892 19:54150305-54150327 GGGGGCTAACAGCTGCAGGAAGG + Intronic
925546946 2:5026747-5026769 GAGTGCTAACTGATGCAATCCGG - Intergenic
925767466 2:7250530-7250552 GGATGACAACAGAAGCAGTGGGG - Intergenic
925920447 2:8634287-8634309 GGGTGCTTACAAGTGAAGTGGGG - Intergenic
928596070 2:32860300-32860322 GGCAGCTACCAGAGGCAGTGAGG - Intergenic
935271241 2:101436050-101436072 GGGTGCCCACAGATGCAGCAGGG - Intronic
937306573 2:120875262-120875284 GGGTGCTAACAGGCACAGTGTGG + Intronic
938743414 2:134254027-134254049 GTGTGTTAACAGGTGTAGTGGGG - Intronic
941693350 2:168525105-168525127 TGGTGCCCACAGGTGCAGTGTGG + Intronic
941996263 2:171604687-171604709 AGGTGCTAACAGAGGCAAGGAGG + Intergenic
943137771 2:183937420-183937442 GGGTGCCAACAGTTGCAGGCAGG - Intergenic
944464681 2:199988823-199988845 GGCTGCTACCAGATGCAGCTTGG + Intronic
946166901 2:217869881-217869903 AGGTGAGAACAGTTGCAGTGTGG - Intronic
946236597 2:218328107-218328129 GGGTGCTAAAAGATGTGGTAAGG - Intronic
947922989 2:233894386-233894408 GGGTGGGAGCAGATGCTGTGGGG - Intergenic
948489629 2:238304204-238304226 AGGTGCTAGCAGAGGAAGTGGGG - Intergenic
948652794 2:239459048-239459070 GGGAGCTTTCAGATGCAGGGAGG - Intergenic
1173434169 20:43017502-43017524 GGGGACAAACAGATGCAGAGGGG - Intronic
1173730761 20:45326901-45326923 GGGGGCTAACGGATGTTGTGTGG - Exonic
1177910426 21:27024471-27024493 CTTTGCTAACAGATGCAGGGAGG + Intergenic
1181977989 22:26745578-26745600 TGGTGCTCACAGTTGCATTGGGG - Intergenic
1182520291 22:30881144-30881166 GGGTGCTCTGAGATGCAGAGGGG - Intronic
1184099628 22:42335281-42335303 GGGTGCTGATAGAGGCAGGGTGG - Intronic
1185058613 22:48593844-48593866 GGATGCTCACAGTTGCACTGGGG - Intronic
950318358 3:12025804-12025826 GGCTGCTAAGAGATTCAGTGAGG - Intronic
956885694 3:73557036-73557058 TGGTGCTCATAGATGCAGGGAGG + Intronic
962145594 3:132836455-132836477 GTGTGCTAACAGTCCCAGTGTGG - Intergenic
963531356 3:146476586-146476608 GGCAGCTAGCAGCTGCAGTGAGG - Intronic
963755314 3:149228859-149228881 GGCTTTTAACAAATGCAGTGGGG - Intergenic
966706992 3:182927097-182927119 GGGTGCCAAGACATTCAGTGGGG + Intergenic
968594930 4:1477353-1477375 GGGTCCTACCAGAACCAGTGAGG + Intergenic
969528129 4:7714515-7714537 TGGTTCTAACAGATGGAATGAGG - Intronic
971441398 4:26691495-26691517 GGCTGCTAACTGATCCAGGGTGG - Intronic
973884147 4:55303796-55303818 GGGTGGAGACAGATGAAGTGAGG - Intergenic
975293262 4:72702178-72702200 AGGTGCTGACAGATTCAGTCTGG - Intergenic
975335792 4:73173838-73173860 GGGCCCTATCAGATGCAGTCAGG - Intronic
975582892 4:75922534-75922556 CAGTGCTAATAGATGGAGTGGGG - Intronic
979885050 4:126016750-126016772 GGATGCTAGCACATGCAGTGTGG - Intergenic
980515343 4:133850794-133850816 GGTTGGTAAGAGATGCTGTGTGG + Intergenic
985000920 4:185481697-185481719 GAGTGCTAGCAAAAGCAGTGTGG - Intergenic
990906974 5:60814352-60814374 AGGTGTTAACAGATTCTGTGAGG + Intronic
990938335 5:61174219-61174241 TGGTGGGAAAAGATGCAGTGTGG + Intergenic
990993971 5:61712682-61712704 TGGTGCTAGCAGAGGCATTGGGG + Intronic
992111833 5:73501680-73501702 GGATGGTAGCAGATGCAGTCAGG + Intronic
995922354 5:117329471-117329493 TGGTGGGAAAAGATGCAGTGTGG + Intergenic
996198574 5:120641298-120641320 TGGTGCTAACAGATTAACTGAGG + Intronic
996664603 5:126044029-126044051 GAAGGCTAACAAATGCAGTGAGG - Intergenic
997701901 5:135908210-135908232 AGGTGTTGACAGAGGCAGTGTGG + Intergenic
1003842969 6:10141450-10141472 ATTTGCTAACAGATGCATTGAGG - Intronic
1006633093 6:35443347-35443369 GGGTGCTGACAGCTGTAGTGGGG - Intergenic
1006829300 6:36959093-36959115 GGATGCCCACAGATGCTGTGGGG - Intronic
1008150884 6:47949837-47949859 AGGTGCTAACTAATGCAGTAAGG + Intronic
1013983772 6:116165627-116165649 GGTTGGTAACAGATGTAGAGGGG - Intronic
1016372545 6:143390325-143390347 AGGTGCCAGCAGATGCGGTGAGG - Intergenic
1016548155 6:145247074-145247096 GGGTTCCGGCAGATGCAGTGGGG - Intergenic
1020891484 7:13883415-13883437 AGGTGCTACTAGAAGCAGTGAGG - Intergenic
1024278473 7:47698327-47698349 GGGTGCTGCCTGGTGCAGTGTGG + Intronic
1026331084 7:69353249-69353271 GGGTGGTAACAGACTCAATGTGG - Intergenic
1028182230 7:87738468-87738490 GGCTGCAAACAAATACAGTGGGG - Intronic
1029101390 7:98133312-98133334 AGGTTCTAACAGCTGCAGTCAGG + Intronic
1032437541 7:131912495-131912517 AGGTAGGAACAGATGCAGTGGGG - Intergenic
1035145299 7:156810127-156810149 TGGTGCCAACAGCTGCTGTGAGG + Intronic
1035813107 8:2509646-2509668 GGAGGCTTACAGATGCAGTGAGG - Intergenic
1037367452 8:18138096-18138118 GAGAGCTCACAGATGCAGAGAGG + Intergenic
1040285042 8:46095224-46095246 GGATGTTGACACATGCAGTGGGG + Intergenic
1046022718 8:108685648-108685670 GAGTCCTAACAAATGCAATGAGG + Intronic
1046449660 8:114371738-114371760 GGGTGCTGACGGAGGGAGTGGGG - Intergenic
1049619947 8:143593559-143593581 GGGTGCTCCCTGCTGCAGTGTGG - Intronic
1049931248 9:458823-458845 GGGTACCAAGAGATGCAGGGGGG + Intronic
1051198140 9:14586383-14586405 TGGTCCAGACAGATGCAGTGAGG - Intergenic
1051283550 9:15469037-15469059 GGATGTGAACAGATGCATTGAGG - Exonic
1059796618 9:117704439-117704461 TGCTGCTCACAGAAGCAGTGAGG + Exonic
1059950882 9:119461424-119461446 GAGTGCTAGATGATGCAGTGGGG - Intergenic
1060498907 9:124138083-124138105 TAATGCTAACAGATGGAGTGGGG + Intergenic
1061819900 9:133221383-133221405 GGGTGTGCACAGATGCAGGGAGG + Intergenic
1062230293 9:135478875-135478897 GGGGGCTTACAGAAGCAGCGCGG + Intergenic
1062240756 9:135536565-135536587 GGGTGTGCACAGATGCAGGGAGG - Intergenic
1188013687 X:25084702-25084724 GGGTGTTAACAGATGGAGGCAGG - Intergenic
1190145750 X:47890235-47890257 GGGTGCTATAAGCAGCAGTGGGG + Intronic
1193399086 X:81021059-81021081 GGGGTCTAACAGCTGCACTGTGG + Intergenic
1195021046 X:100829039-100829061 GGAAGTTAACAGAGGCAGTGTGG - Intronic
1198404259 X:136296640-136296662 AGGTTCTAACAGATCTAGTGTGG + Intergenic
1200093565 X:153647091-153647113 GGGTGCTAGCCGAAGCAGTCGGG - Intronic