ID: 1162843379

View in Genome Browser
Species Human (GRCh38)
Location 19:13372546-13372568
Sequence CAGATCTGCCACTTTCCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 300}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162843375_1162843379 0 Left 1162843375 19:13372523-13372545 CCAGCCTGCATGGGTTCAGATCC 0: 1
1: 0
2: 23
3: 186
4: 658
Right 1162843379 19:13372546-13372568 CAGATCTGCCACTTTCCAGTTGG 0: 1
1: 0
2: 3
3: 39
4: 300
1162843374_1162843379 1 Left 1162843374 19:13372522-13372544 CCCAGCCTGCATGGGTTCAGATC 0: 1
1: 0
2: 0
3: 26
4: 183
Right 1162843379 19:13372546-13372568 CAGATCTGCCACTTTCCAGTTGG 0: 1
1: 0
2: 3
3: 39
4: 300
1162843376_1162843379 -4 Left 1162843376 19:13372527-13372549 CCTGCATGGGTTCAGATCCCAGA 0: 1
1: 0
2: 1
3: 32
4: 226
Right 1162843379 19:13372546-13372568 CAGATCTGCCACTTTCCAGTTGG 0: 1
1: 0
2: 3
3: 39
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162843379 Original CRISPR CAGATCTGCCACTTTCCAGT TGG Intronic
901138409 1:7012340-7012362 CAGATCTGCCACTTTCTTTCTGG + Intronic
901287854 1:8095730-8095752 CTGTTCTGCCACTTACTAGTAGG - Intergenic
901501850 1:9657430-9657452 CTGTTCTGCCACTTTCCCCTGGG + Intronic
902960755 1:19961538-19961560 CAGACCTGCCACTGCCCTGTGGG - Intergenic
903418324 1:23200130-23200152 CAGCTCTGCCACTGACCAGCTGG + Intergenic
905218125 1:36424523-36424545 CAGCTCTGCCCCTTACCAGCTGG - Intronic
905273409 1:36801730-36801752 CAGAGCTGCCACCTGCCTGTTGG - Exonic
906583507 1:46955810-46955832 CAGATCTGTCACTATCCAAGGGG + Intergenic
908474518 1:64474384-64474406 CAGCTCTGCCATTTGCAAGTTGG + Intronic
910225927 1:84936052-84936074 CATCTCTGCCACTTTCTAGCTGG + Intronic
916578477 1:166087666-166087688 CAGCTCTGCCACTTACAAGCTGG - Intronic
917498784 1:175566939-175566961 AAGATGTGCCACATTTCAGTAGG - Intronic
917842757 1:178995416-178995438 CCCAGCTGCTACTTTCCAGTGGG - Intergenic
918703855 1:187637614-187637636 CAGATCGTCCCCTTTCCACTTGG + Intergenic
919550232 1:198976583-198976605 CAGATCTGACACTTACTATTAGG - Intergenic
920361752 1:205422842-205422864 CAGTTCTGCCATTTACCAGCTGG + Intronic
921863664 1:220065600-220065622 CAGTTCTGCCATTTACCAGCTGG + Intronic
922159384 1:223067441-223067463 AAGGTCTGCCACTTACCAGTGGG + Intergenic
922413980 1:225403615-225403637 ACCTTCTGCCACTTTCCAGTGGG - Intronic
922684605 1:227629510-227629532 CAGATCTGTCACTATCCAAGGGG - Intronic
924950240 1:248875374-248875396 CATATCTGTGACTTTCAAGTTGG - Intergenic
1064669230 10:17692168-17692190 CAGATCTACCACTTTCTAGCTGG - Intronic
1065199487 10:23299633-23299655 CAGATCTGTCACTATCCAAGGGG - Intronic
1066525994 10:36280482-36280504 CATTTCAGCCACTTTCCAGAGGG + Intergenic
1067508217 10:46874271-46874293 CAGGACTGACACTTTCCATTTGG + Intergenic
1067654034 10:48177574-48177596 CAGGACTGACACTTTCCATTTGG - Intronic
1068129541 10:52880459-52880481 CAGCTCTGCTACTTACCAGCCGG + Intergenic
1069089759 10:64185665-64185687 CAGAGCTGCCACTACCAAGTTGG - Intergenic
1069216492 10:65827695-65827717 GAGATCTGCCAGTTCCCTGTGGG + Intergenic
1069651949 10:70055083-70055105 CTGGTCTGCCATTTCCCAGTGGG + Intronic
1070540953 10:77414844-77414866 CAGCTCTGCCACTTACAAGATGG - Intronic
1071807973 10:89145176-89145198 TAGCTCTGCCATTTTCCAGCAGG + Intergenic
1072378018 10:94837632-94837654 CAGATCTGTCACTATCCAAGGGG - Intronic
1074720922 10:116264455-116264477 CAAGTCTCCGACTTTCCAGTGGG + Intronic
1074957954 10:118410938-118410960 CAGCACTGCCGCTTTCCAGAAGG + Intergenic
1075647559 10:124106526-124106548 CAAGCCTGCCACTTTCCACTGGG + Intergenic
1076249351 10:128972929-128972951 CAGACCTGCCAGTTCACAGTAGG - Intergenic
1076942719 10:133620503-133620525 CAGATCTGCAACTGGCCAGCTGG - Intergenic
1077769307 11:5197849-5197871 CAGATTGGCCACATTCCAGTCGG + Intergenic
1077854614 11:6110616-6110638 CAGTACTGCCACTTCCCAGTGGG - Intergenic
1078328089 11:10396756-10396778 CAGGTCTGCCACTTTGAAGCTGG - Intronic
1079933647 11:26593419-26593441 CAGATCTGTCACTATCCAAGGGG - Intronic
1080127563 11:28754865-28754887 CAGCTCTGCTACTTACTAGTGGG + Intergenic
1080174070 11:29340867-29340889 CAGTCCTGCCACATTCAAGTAGG - Intergenic
1083683541 11:64362159-64362181 CACATCTGCCAAGTTTCAGTGGG - Intronic
1084255531 11:67939840-67939862 CAGATCTGGGAATGTCCAGTTGG - Intergenic
1084817216 11:71655465-71655487 CAGATCTGGGAATGTCCAGTTGG + Intergenic
1084930097 11:72548336-72548358 CAGCTCTGCCTCTTTCCAGCTGG + Intergenic
1085283107 11:75343629-75343651 CAGCTCTGACACTTACCAGCTGG - Intronic
1085601689 11:77861358-77861380 CAGATCTGTCACTATCCAAGGGG - Intronic
1085760691 11:79238594-79238616 ATGATCTGCCACCTTCCAGGAGG - Intronic
1086006316 11:82042380-82042402 CAGCTCTACCACTTTCTAGCTGG + Intergenic
1086061418 11:82703452-82703474 AAGCTCTGCCACTTCCCAGCAGG - Intergenic
1086141912 11:83508782-83508804 CAGTTCTGCCACTTGCCGGCTGG - Intronic
1088339130 11:108743171-108743193 CAGATCTGCCACAATCAAGTAGG + Intronic
1088709844 11:112498402-112498424 CAGTTCTGCCATTTACCACTCGG - Intergenic
1089947139 11:122487671-122487693 CAGCTCTGCCACTTACTAGCTGG - Intergenic
1090105759 11:123852363-123852385 CTGATCTGATACTTTCCACTAGG - Intergenic
1090353809 11:126125617-126125639 CAGCTCTGCCACTCACCAGCTGG - Intergenic
1090610094 11:128463382-128463404 CAGCTCTGCCACTTGCCACCCGG - Intronic
1090821072 11:130342320-130342342 CAGCTCTGCCATTTTCTAGTTGG - Intergenic
1090958767 11:131537373-131537395 AAGAGCTGCCACCTTCCGGTGGG + Intronic
1092050451 12:5465982-5466004 CAGCTCTACCACTTACAAGTTGG - Intronic
1092425767 12:8374574-8374596 CAGATCTGGGAATGTCCAGTTGG - Intergenic
1093031101 12:14289261-14289283 CAGTTCTGCCACTAACCACTTGG + Intergenic
1093130867 12:15390506-15390528 AAGACCTGCCACCTCCCAGTGGG + Intronic
1093626025 12:21349112-21349134 AAGATCTGTCCCTTTCCAGATGG + Intronic
1094628073 12:32144822-32144844 CTGATCAGTCACTCTCCAGTGGG - Intronic
1096552205 12:52380497-52380519 CAGATCTGCCAGCTTGCATTTGG + Exonic
1096612976 12:52815196-52815218 CAGATCTGTTACTGTTCAGTTGG - Intergenic
1097924163 12:65109393-65109415 CAGAGCTGCCTCTGTCCAGAGGG - Intronic
1098357940 12:69628787-69628809 CAGAAATGCCACTTCCTAGTTGG + Intergenic
1101567345 12:105920638-105920660 GAGATCTGGCACTTCTCAGTGGG + Intergenic
1102005815 12:109588567-109588589 CAGCTCTCCCACTTGCCAGCTGG + Intronic
1102192766 12:111001547-111001569 CAGCTCTGCCACTTGCTAGCTGG + Intergenic
1102614759 12:114143918-114143940 CAGATCTCTGAATTTCCAGTTGG - Intergenic
1102619794 12:114185008-114185030 CACACCTGCCACTTTCTGGTTGG - Intergenic
1102718668 12:114997264-114997286 CAGATCTGCCTCCTCCCTGTAGG + Intergenic
1102884352 12:116510288-116510310 CATCTCTGCCACTTACTAGTGGG + Intergenic
1103360800 12:120352465-120352487 CAGCTCTGCCACTTCCTAGTTGG + Intronic
1103742101 12:123097821-123097843 TACATCTGCCACTTGGCAGTGGG + Intronic
1104944571 12:132409869-132409891 CAGAGCTGCCACCGTCCTGTGGG + Intergenic
1105225717 13:18429765-18429787 CAGATTGTCCACTTTCCACTAGG + Intergenic
1105914535 13:24900784-24900806 CAGAGCTGCCACTCTCCACCAGG - Intronic
1106223613 13:27768645-27768667 AACATCTACCACTTTCCACTGGG + Intergenic
1106891510 13:34251103-34251125 CAGAACAGTCACTTTCCAATAGG - Intergenic
1108041684 13:46345259-46345281 CGGCTCTGCCACTTACCAGCAGG + Intronic
1109710258 13:66149905-66149927 CAGAACGGCCAGTTTCCACTTGG - Intergenic
1110359434 13:74608838-74608860 TAGAGCTGCCACTATCCACTTGG + Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112400934 13:99077770-99077792 CAGACCTGCCACATTCAAGATGG + Intronic
1112836996 13:103527894-103527916 CTGTTCTGGCACTGTCCAGTGGG + Intergenic
1115098328 14:29667088-29667110 AAGATCCACCACTTTCCATTAGG - Intronic
1118866652 14:69709662-69709684 CAGCTCAGCCATTTACCAGTGGG - Intronic
1119420302 14:74504148-74504170 CAGCTCTGCCACTTACTAGGTGG + Intronic
1119531176 14:75362377-75362399 CAGAGGTGGCACTATCCAGTGGG + Intergenic
1119638587 14:76296700-76296722 CAGCTCTGCCTCTTTCAAGGTGG + Intergenic
1120304946 14:82757824-82757846 CAGATCTGCAAATTTCCACTTGG + Intergenic
1121120992 14:91375829-91375851 CTGATCTGACCCTTTCCAGCAGG + Intronic
1121245827 14:92460203-92460225 CAGTTCTGCCACTCACCAGCAGG + Intronic
1121514207 14:94538484-94538506 CAGGCCTGCCACCTTCCACTGGG - Intergenic
1122178443 14:99937681-99937703 GAGACCTTCCACTTCCCAGTCGG - Intronic
1122540647 14:102496084-102496106 GGGATCTGCCAGTTTCCACTGGG + Intronic
1122660371 14:103290837-103290859 CTGACCAGCCACTGTCCAGTGGG + Intergenic
1122792240 14:104188950-104188972 CAGCTCTGCCACTTCCCACCTGG + Intergenic
1126665279 15:51070571-51070593 CAGCTCTGCCACTTTCTAAATGG - Intronic
1127965907 15:63922836-63922858 CAGAGCTCCCACTCTCCAGCTGG + Intronic
1128224493 15:65992517-65992539 CAGATCTGCTAATTGCCACTTGG - Intronic
1128362546 15:66972579-66972601 CAGATCTGTCACTATCCAAGGGG - Intergenic
1128771481 15:70285940-70285962 CAGTGCTGCCACTTACCAGCTGG + Intergenic
1129604377 15:77017682-77017704 CAGGCCAGCCACTTTCCAGCTGG + Intronic
1130560137 15:84951618-84951640 CAGATTTGCCTCTTTCCTGCGGG + Intergenic
1130905305 15:88235842-88235864 CAGCTCTGCCACCTACCAGTTGG + Intronic
1131077635 15:89505759-89505781 CAGATCTGCCACCCTCTAGCTGG - Intergenic
1131781252 15:95862363-95862385 CAGCTCTGCCAATTTCTACTTGG + Intergenic
1132544939 16:528567-528589 CAGATTTGCAACTTCCCAGCTGG - Intronic
1133330880 16:4973156-4973178 CAGCTCTGCCACTTGACAGCTGG - Intronic
1133788610 16:8991980-8992002 CAGCTCTCCCACTTACCAGCTGG - Intergenic
1134008992 16:10837295-10837317 TAGCTCTGCCACTTACCAGTGGG - Intergenic
1134313015 16:13093302-13093324 CATCTCTGCCACTTACTAGTTGG + Intronic
1134686518 16:16162618-16162640 CAGCTCTGCCACTTACCAGCTGG - Intronic
1135161998 16:20104685-20104707 CAGCTCTGCCCCTTTCTAGCTGG - Intergenic
1135224810 16:20646536-20646558 CAGATCTGTCACTATCCAAGGGG + Intronic
1135391728 16:22099416-22099438 CACATCTGCCACTTTCTAGCTGG + Intronic
1136282188 16:29220468-29220490 CAGAGCTGCTCCTTTCCAGCAGG + Intergenic
1136473849 16:30499542-30499564 CAGCTCCGTCACTGTCCAGTGGG + Intronic
1137488581 16:48912115-48912137 CAGAGCTGCCTGCTTCCAGTGGG - Intergenic
1137966672 16:52941539-52941561 CAAGGCTGCCACTTTCTAGTGGG + Intergenic
1138162371 16:54766480-54766502 CAGCTCTGCCACTTACTAGCTGG + Intergenic
1139171535 16:64635891-64635913 CAGCTCTGGCATTTTGCAGTAGG + Intergenic
1139558943 16:67729660-67729682 CAGGTCAGCCACTCTCCAGAGGG - Exonic
1139588116 16:67917243-67917265 CAGATGTGCCACCCTCCAGTCGG - Intronic
1141275080 16:82580061-82580083 CAGTTCTGCCACTTATGAGTTGG + Intergenic
1141519043 16:84565344-84565366 CAGCTCTGCCACTTTCTATCTGG + Intergenic
1141526460 16:84614912-84614934 CAACTCTGCCACTTTCTAGCTGG + Intronic
1141527275 16:84619179-84619201 CAGTACTGCCACTTTCCAACTGG + Intergenic
1141675028 16:85513323-85513345 CAGCTCAGCCACTTTGCAGCTGG + Intergenic
1141888855 16:86912960-86912982 CAGACCTGCCCCATGCCAGTAGG + Intergenic
1142086559 16:88186387-88186409 CAGAGCTGCTCCTTTCCAGCAGG + Intergenic
1143340579 17:6207827-6207849 CAGCTCTGCCACTCACCAGCTGG - Intergenic
1145740449 17:27269822-27269844 CTGATCTCCCACTTGCCACTTGG + Intergenic
1146168147 17:30608193-30608215 CACATCTGCCACTCTCAAGCTGG - Intergenic
1146221115 17:31021674-31021696 CACATCTGCCACTCTCAAGCTGG - Intergenic
1146569614 17:33941312-33941334 CAGATCTGCCCCATCCCAGTGGG + Intronic
1146661620 17:34668665-34668687 CAGTTCTGCCACTTACCTGCTGG + Intergenic
1147565185 17:41531791-41531813 CAGATCTGCCTCAGTTCAGTCGG - Intergenic
1147675761 17:42204200-42204222 CTCATCTGCCACATCCCAGTGGG - Intronic
1148908246 17:50925379-50925401 CAGATGTGCCATGTTCCTGTAGG + Intergenic
1149776852 17:59365117-59365139 TAGTTCTGTCACTTTCCATTTGG - Intronic
1150072687 17:62165457-62165479 CACACCTGGCCCTTTCCAGTGGG + Intergenic
1150366682 17:64593771-64593793 CACATCTGCCACTCTCAAGCTGG + Intronic
1150433413 17:65137018-65137040 CAGCTCTGCCACTAACCAGCCGG - Intergenic
1150495531 17:65605281-65605303 CAGCTCTGCAATTTTCTAGTCGG + Intronic
1151224138 17:72636211-72636233 CATCTCTGCCACCTCCCAGTGGG + Intergenic
1151328015 17:73390771-73390793 CAGCTCTGTCACTTACCAGCAGG - Intronic
1151692945 17:75698189-75698211 GAGATCTGCCACTGTCCGGCAGG - Intronic
1151875823 17:76867920-76867942 CAGATCCTCCACTAGCCAGTGGG - Intergenic
1152267745 17:79306179-79306201 CAGCTCTGCCAGTTCCCAGCTGG + Intronic
1153197512 18:2616982-2617004 CAAATGTGGCATTTTCCAGTTGG + Intergenic
1153650790 18:7238042-7238064 CAGAGCTTTCATTTTCCAGTGGG - Intergenic
1156735555 18:40254199-40254221 GAGCTCTGCCACTGTCCAGCAGG + Intergenic
1156984008 18:43327399-43327421 CAGTTCTGCCATTGTCAAGTGGG + Intergenic
1157309833 18:46544205-46544227 TAGCTCTGCCACTTACCACTGGG + Intronic
1157804177 18:50645804-50645826 CAGTTCTGCCACTTTCCAGATGG + Intronic
1158932956 18:62338974-62338996 CAGAGTTGCCACTTTGCTGTCGG + Intronic
1160619070 18:80157910-80157932 CAGTTCTGCCACTGACCAGCAGG + Exonic
1161729595 19:5951321-5951343 CAGACCAGCCACTTTCCCTTCGG - Intronic
1161961207 19:7524219-7524241 CAGACCTGCCACTTTACAGTAGG - Intronic
1162328896 19:10014900-10014922 CAGCTCTGCTACTTTGCAGCTGG - Intronic
1162843379 19:13372546-13372568 CAGATCTGCCACTTTCCAGTTGG + Intronic
1164182203 19:22829245-22829267 CAGTTCTGCTATTTTACAGTAGG + Intergenic
1165308404 19:35016109-35016131 CAGCTCTGCCACTTACTAGCTGG + Intronic
1165986378 19:39772517-39772539 CTGTTCTGCCACTGGCCAGTGGG + Intergenic
1166939986 19:46356609-46356631 CAGCTCTGCCACTTCCCTGCTGG - Intronic
1167022797 19:46891077-46891099 CAGCTCTGCCACTTTCCATCTGG + Intergenic
1167451334 19:49571579-49571601 CAGCTCTGCCATTTCCCAGCTGG - Intronic
1167744340 19:51341853-51341875 CTGATCTGGAACTTTCCAGCTGG + Exonic
1168057488 19:53871296-53871318 CAGATTTCCAACTGTCCAGTAGG - Intronic
1168713599 19:58514875-58514897 CACATCTGCCACCTTCCTGCAGG + Intronic
926189218 2:10715274-10715296 CAGTTCTGCCACTTACTAGCTGG - Intergenic
929022302 2:37565780-37565802 CACATCTGCCACTAGCCAGTGGG + Intergenic
929761274 2:44809366-44809388 TAGTTCTGCCACTTTCTAGTTGG + Intergenic
929916113 2:46137213-46137235 CAACTCTGCCACTTACCAGCTGG - Intronic
929934109 2:46281892-46281914 CAGCTAGGCCACTTGCCAGTTGG - Intergenic
931202356 2:60110614-60110636 CAGATGTGCCAGCTGCCAGTAGG - Intergenic
932877175 2:75464993-75465015 CAGATCTACCTCTTCCCTGTAGG - Intergenic
932915249 2:75850790-75850812 CAGTTCTGCCACTTACTAGCTGG + Intergenic
933742129 2:85542334-85542356 CAAATCTGCCACTTGGCTGTAGG - Exonic
936536239 2:113313704-113313726 CAGCTTTGCCACTTATCAGTGGG - Intergenic
938779051 2:134568148-134568170 CAGATCTATCATGTTCCAGTAGG + Intronic
939493571 2:142903527-142903549 CAGATCTGTCACTATCCAAGGGG - Intronic
940070043 2:149676712-149676734 TAGCTCTGCCACTTACCAGCTGG - Intergenic
940279918 2:151978490-151978512 CAGCTGTGCCACTTCCCAGCAGG + Intronic
941317321 2:164009283-164009305 AAGATATGCCACCTTCCAGCAGG - Intergenic
941452965 2:165681525-165681547 CAGCTCTTCCACTGTGCAGTTGG + Exonic
941746141 2:169088676-169088698 CAGTTCTGCCACTTACCAGCTGG - Intronic
943329845 2:186545955-186545977 CAGCTCTACCACTTTCTAGTTGG - Intergenic
943734227 2:191336305-191336327 CATCTCTGTCACTGTCCAGTTGG - Intronic
943776957 2:191775954-191775976 CAGAGCTACCACTAACCAGTTGG + Intergenic
947543104 2:230991849-230991871 AAGGTCTGCCACTCTCCAGCTGG + Intergenic
947750832 2:232531156-232531178 CAGCTCTGCCACTTACTAGCTGG - Intronic
1168741321 20:193774-193796 CAGATCTGTCACTATCCAAGGGG - Intergenic
1169553255 20:6723075-6723097 CAGGTCTGCCACTTTCTACTTGG - Intergenic
1170276020 20:14589795-14589817 CAGATGTACCATTTTCCAGCTGG - Intronic
1172503518 20:35444029-35444051 CAGTTCTGCCATTTGCCAATTGG + Intronic
1173912107 20:46678077-46678099 CAAATCTTCCACTTTACAGGTGG + Intronic
1174123593 20:48286530-48286552 CAGCTCTGCTACCTCCCAGTGGG - Intergenic
1174846332 20:53947120-53947142 CAGACCTGCCACTTCCTAGCTGG + Intronic
1175641599 20:60634960-60634982 CAGAACTGCCACTTTCTAACAGG + Intergenic
1178754424 21:35335058-35335080 CTGCTCTGCCACTTTCCACTGGG - Intronic
1178816789 21:35937917-35937939 CACAACTGCCAATTTCCTGTTGG + Intronic
1179047308 21:37857475-37857497 CAGATCTGCCATTTTGCAAAGGG + Intronic
1179124816 21:38581279-38581301 CAGATCTGCCACTTACTCCTTGG + Intronic
1179401566 21:41089425-41089447 CAGATCTGCCATTCTCCCCTAGG + Intergenic
1181373089 22:22433105-22433127 CAGATCTGCAACTTCCAAGGAGG - Intergenic
1181623749 22:24108207-24108229 CAGATCTGCCACTTAGGGGTTGG - Intronic
1182434304 22:30320514-30320536 CAGTTCTGCCATTTACCAGCTGG + Intronic
1182787193 22:32917766-32917788 CAGATCTGCCGCTGGCCTGTTGG + Intronic
1182986608 22:34724331-34724353 CAGATCTGCCACCTTTCAACAGG - Intergenic
1183104457 22:35606338-35606360 CAGCTCTGCCACTTACTAGCAGG + Intergenic
1184042719 22:41953466-41953488 TAGCTCTGCCACTTTCCAGTTGG + Intergenic
949777878 3:7652467-7652489 TAGCTCTGCCCCTTTCTAGTGGG + Intronic
949965330 3:9351150-9351172 CACATCTGCCACATTCTAGGGGG + Intronic
950126905 3:10515135-10515157 CAGCTCTGCCACTTACCACTGGG + Intronic
950750999 3:15127914-15127936 CAGATCTGGGAATGTCCAGTTGG + Intergenic
951019484 3:17766965-17766987 CAGGTTTGCCTCCTTCCAGTAGG + Intronic
951801572 3:26602623-26602645 TAGCTCTTCCACTTTCCAATAGG + Intergenic
953403928 3:42651081-42651103 CAACTCTGCCACTTCCCAGTTGG + Intergenic
953481663 3:43257338-43257360 CATGTCTGCCACTTTCCTGCTGG + Intergenic
953771341 3:45780464-45780486 CAGTTCTGCCACTTAACAGCCGG - Intronic
954065176 3:48100151-48100173 CAGATCTACCACTTACTGGTTGG - Intergenic
954356876 3:50089191-50089213 CAGCTCTGTCAGTTTCCAGAGGG + Intronic
955507812 3:59649220-59649242 CAGATCTGCCAGTTTTCTGGTGG - Intergenic
960417429 3:117401568-117401590 TAGGTCGGCCACTTTCCACTGGG - Intergenic
960703858 3:120463031-120463053 GAGACCTGCCACTTACTAGTTGG + Intergenic
961344608 3:126255899-126255921 CTGTTCTGCTACTTACCAGTGGG + Intergenic
961518566 3:127454043-127454065 CAGACTTGCCACTTTCCAGCTGG - Intergenic
962277543 3:134027685-134027707 TAGCCCTGCCACTTTGCAGTGGG - Intronic
962611491 3:137080969-137080991 CAGCTCTACCACTTTCCAATTGG - Intergenic
963442292 3:145355622-145355644 CAGATCACCCCCTTTCCACTTGG - Intergenic
963781937 3:149495206-149495228 CAGCTGTACCAATTTCCAGTTGG + Intronic
964864589 3:161242398-161242420 TTGACCTGCCACTTCCCAGTTGG + Intronic
965648093 3:170905845-170905867 TAGTTCTGTCACTTTCTAGTTGG - Intronic
965686552 3:171309394-171309416 CCCATCCTCCACTTTCCAGTAGG - Intronic
966353588 3:179056749-179056771 CAGATCTGTCACTATCCAAGGGG + Intronic
966876351 3:184324081-184324103 CAGCTCTGCCTCCTTCCAGCTGG - Intronic
967582421 3:191175144-191175166 CATCTCGGCCACTTTCCAGCTGG + Intergenic
967623642 3:191662496-191662518 CAGATCTGTCACTATCCAAGGGG + Intergenic
970250979 4:14115793-14115815 CAGCTCTGCCACTGGCCAGCTGG - Intergenic
970309851 4:14770677-14770699 TAGCTTTGCCACTTTCCAGCTGG + Intergenic
970356388 4:15257525-15257547 CAGCTCAGCCACTTAACAGTGGG + Intergenic
970858514 4:20675565-20675587 CAGCTCTGCCACTTCCTAGCTGG + Intergenic
972579137 4:40379621-40379643 CAGCTCAGCCACAGTCCAGTAGG + Intergenic
973650699 4:52994485-52994507 CAGATCTCTCACTGACCAGTGGG - Intronic
977284254 4:95082638-95082660 CAGATCTGCCATTTACTATTTGG - Intronic
977857464 4:101911122-101911144 CAGCTCTGCCACTTACCATCTGG - Intronic
978235667 4:106455720-106455742 GAGAGCTGCCACTTTTCAGCGGG + Intergenic
978427663 4:108598750-108598772 CAGCTCTGCCACTTAACAGAGGG + Intergenic
979352768 4:119664730-119664752 CTGCTCTGCCACTTACCAGGTGG - Intergenic
980203021 4:129679748-129679770 CAGTTCTGCCACTTAAAAGTTGG - Intergenic
982604186 4:157492965-157492987 CAGGACTTCCACTTTCCAGTAGG + Intergenic
984025706 4:174540429-174540451 CAGACTTGCCTCTTTGCAGTAGG + Intergenic
986811903 5:11368761-11368783 CAGATCTGTCTCTAACCAGTTGG + Intronic
988148183 5:27338367-27338389 CACATCACTCACTTTCCAGTGGG + Intergenic
990458378 5:56010887-56010909 CAGTAGTGCCACTTTCCAGATGG - Intergenic
992025461 5:72665033-72665055 CAGCTCTGCCACTTTCTAGCTGG - Intergenic
994110749 5:96001096-96001118 ATGATCTGCCACTTTACACTGGG - Intergenic
994148270 5:96419558-96419580 TAGATCTGCCACTTAGTAGTTGG - Intronic
994817666 5:104604843-104604865 CAGACCTGCCAGTTCCCAGCTGG + Intergenic
997435369 5:133870288-133870310 CAGGTCTTCCACCTTCCAGAGGG - Intergenic
997697721 5:135874528-135874550 CAGCTCTGGCACTTCCCACTGGG - Intronic
999428705 5:151508058-151508080 CAGATCAGCCACCTTACAATGGG + Intronic
1001924033 5:175623184-175623206 CAGCTCTGCCATTTGCTAGTTGG + Intergenic
1002451005 5:179318476-179318498 CAGCTGTCCCACTTTGCAGTGGG - Intronic
1002884126 6:1278832-1278854 CAGCTCTGCCACTTGCAAGCTGG - Intergenic
1003808994 6:9758798-9758820 CACATCTGCTTCTTTCCTGTGGG - Intronic
1004454620 6:15780537-15780559 CAGCTCTGCTACTTACCAGCTGG - Intergenic
1004853005 6:19719713-19719735 CAGATCAGCCACATTCCAATCGG + Intergenic
1006192609 6:32218849-32218871 CAGCTCTGCCACTTGCTAGCTGG + Intronic
1006366353 6:33618421-33618443 CAGCTCTGCCACTTTCTAGCAGG - Intergenic
1006562888 6:34928798-34928820 CAGAGCTGCCATTTTCAAGGTGG + Intronic
1007828976 6:44624003-44624025 CAGTTCTCCCTCTTTCTAGTTGG + Intergenic
1009942978 6:70310649-70310671 CAGCTCTACCACTTTCTAGCTGG + Intergenic
1010240968 6:73615077-73615099 CAGTTCTGACACTGTCCAGCTGG - Intronic
1011137684 6:84117710-84117732 CAGTTTGGCCACTCTCCAGTAGG + Intergenic
1011189696 6:84716322-84716344 CAGATCTGTCACTATCCAAGGGG - Intronic
1011686933 6:89830816-89830838 CAGCTCTGCCACTTACCAGGTGG + Intronic
1013745640 6:113342823-113342845 CAAATCTGCCCCTTCACAGTTGG + Intergenic
1016554071 6:145315497-145315519 CAGAACAGCCTCTTTCCTGTAGG + Intergenic
1016782848 6:147979063-147979085 CAGAAATGCCACTTTGGAGTGGG + Intergenic
1016951742 6:149587316-149587338 CAGTTCTGACACTTTCCACCTGG + Intronic
1019960595 7:4456289-4456311 CAGATCAGCCAGTTTCCTCTAGG - Intergenic
1021915178 7:25424395-25424417 CTGTTCTGCCACTTCCCAGTGGG - Intergenic
1021947535 7:25743130-25743152 CAGATTTGTCACTTTCCCTTTGG - Intergenic
1022553916 7:31272457-31272479 CAGCTCTGCCTCTTTCCTGTTGG + Intergenic
1023326791 7:39069463-39069485 AAAATCTGTCACTTCCCAGTGGG - Intronic
1028654595 7:93189823-93189845 CAGAGCTGGCACATTCAAGTTGG + Intronic
1029072717 7:97913170-97913192 CAGATCTGGGAATGTCCAGTTGG - Intergenic
1030984472 7:116224937-116224959 CACTTCTGCCACTTGCTAGTTGG + Intronic
1033045197 7:137955682-137955704 CAGATCTGCCTCTTTGAGGTGGG - Intronic
1034198475 7:149265888-149265910 CAGCTCTGCCACTTACAAGCTGG - Intronic
1034696065 7:153054956-153054978 CAGCTCTTCCAATTACCAGTTGG - Intergenic
1039697185 8:39925580-39925602 CAGCTCTGCCACTTTCTAGCTGG - Intronic
1040072009 8:43196104-43196126 CAGCTCTGCCACTTCCCAGCTGG + Intronic
1040527664 8:48239000-48239022 CAGATCTGTCACTATCCAAGGGG - Intergenic
1041313687 8:56540605-56540627 CATCTCTGCCACTTCCAAGTCGG - Intergenic
1042977714 8:74488781-74488803 CTGATCTGGCACCTGCCAGTTGG + Intronic
1043490054 8:80740084-80740106 CAGATCTGTCACTATCCAAAGGG + Intronic
1044300916 8:90581928-90581950 CAGCTCTGCCACTCACCAGCTGG + Intergenic
1044463643 8:92478533-92478555 CAGTTCTGCCACTTACAACTTGG - Intergenic
1045418676 8:101992548-101992570 CAGCTTTGCCACTTACCAGCTGG + Intronic
1046740274 8:117820279-117820301 CAGATCTACCACTTACTGGTCGG + Intronic
1047392522 8:124464967-124464989 GAAATCTGCCAGTTTTCAGTGGG + Intergenic
1047595662 8:126375250-126375272 CTGAGCTGGCATTTTCCAGTAGG + Intergenic
1050369393 9:4905026-4905048 CAAATCTGCTACATTCCAGTGGG + Intergenic
1052812793 9:33076399-33076421 GAGAGCTGCTACTTTCCTGTGGG + Intronic
1053341429 9:37337538-37337560 CAGAGCTGCCAGTTTCCAGGCGG + Intronic
1056712203 9:89000233-89000255 CAAATGTGCCACTTTTCTGTTGG + Exonic
1057602913 9:96473906-96473928 CAGCTCTGCCACTTACTAGTTGG + Intronic
1057755576 9:97832245-97832267 CAGCTATGCCACTTCCCAGCTGG - Intergenic
1059364534 9:113775856-113775878 AACCTCTGCCACTTTCCAGCTGG - Intergenic
1060269188 9:122128909-122128931 CAGCTCTGCCACTTTCTGGCTGG + Intergenic
1060545942 9:124458993-124459015 CAGCTCTGCCACTTACAAGCTGG - Intronic
1061518165 9:131101707-131101729 CAGATCTGCCACTTCCTGGCTGG - Intronic
1186037581 X:5441514-5441536 CAGATATGCCTTTTTCAAGTAGG - Intergenic
1186254163 X:7701448-7701470 CAGATCTGTCACTATCCAAGGGG - Intergenic
1187368961 X:18688052-18688074 CAGCTCTGCCACTTTCAACCTGG - Intronic
1188852041 X:35143973-35143995 AAGATCAGTCACTGTCCAGTTGG - Intergenic
1189001712 X:36954933-36954955 CAGTTCTGCTATTTCCCAGTGGG + Intergenic
1189946622 X:46187011-46187033 CAGATCTGTCACTATCCAAGGGG + Intergenic
1189947389 X:46193189-46193211 CAGCTCTGCCATTTGCTAGTTGG + Intergenic
1190747155 X:53331151-53331173 CAGTTCTGCACCTTTCCGGTGGG + Intergenic
1191167008 X:57401986-57402008 CAGATCTGTCACTATCCAAGGGG - Intronic
1192214458 X:69149077-69149099 CAGCTCTGCCACTTGGCAGCTGG - Intergenic
1193397167 X:80999255-80999277 CAAATCTGCCACCCTCAAGTAGG - Intergenic
1194138037 X:90172488-90172510 CTGTTCTGCTATTTTCCAGTGGG - Intergenic
1195021043 X:100828970-100828992 TAGCTCTGCCACTTACTAGTTGG - Intronic
1195666876 X:107439837-107439859 CAACTCTGCCACTTACCAGTAGG + Intergenic
1197540841 X:127758627-127758649 TAGATCTGTCATTTTCTAGTTGG - Intergenic
1197876749 X:131116541-131116563 CTGTTCTGCCACTTTCCAAGTGG + Intergenic
1199494176 X:148434807-148434829 GAGATCTGCATTTTTCCAGTTGG - Intergenic
1199681581 X:150228243-150228265 CAGTTCTGCCACTCACCAGATGG + Intergenic
1200483830 Y:3742742-3742764 CTGTTCTGCTATTTTCCAGTGGG - Intergenic