ID: 1162846754

View in Genome Browser
Species Human (GRCh38)
Location 19:13398690-13398712
Sequence CAGTTTCCTCATAGGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 394}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162846746_1162846754 21 Left 1162846746 19:13398646-13398668 CCTGATTATTTACTAATTGTCTA 0: 1
1: 0
2: 1
3: 45
4: 302
Right 1162846754 19:13398690-13398712 CAGTTTCCTCATAGGGAGGTTGG 0: 1
1: 0
2: 2
3: 24
4: 394
1162846745_1162846754 25 Left 1162846745 19:13398642-13398664 CCTGCCTGATTATTTACTAATTG 0: 1
1: 0
2: 4
3: 16
4: 322
Right 1162846754 19:13398690-13398712 CAGTTTCCTCATAGGGAGGTTGG 0: 1
1: 0
2: 2
3: 24
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162846754 Original CRISPR CAGTTTCCTCATAGGGAGGT TGG Intronic
900491298 1:2950430-2950452 CAGTTTCCCCAAATGCAGGTGGG + Intergenic
900808292 1:4782122-4782144 CAGTTTCCTCCCATGGAGGGTGG - Intronic
900918796 1:5657893-5657915 CAGTTTCCTCATCTGGAAGCTGG - Intergenic
902931992 1:19737924-19737946 CAGTTTCTAGATAGGAAGGTGGG + Intronic
903197675 1:21704135-21704157 GAGTTTCCACCTAGGGAGTTGGG + Intronic
903281001 1:22249954-22249976 CAGTTTCCACATCTGGAAGTTGG + Intergenic
903406039 1:23097093-23097115 CTGTTTCCTCACAGGGAAGAAGG + Intronic
903711543 1:25328895-25328917 CAGTTTCCTCATTTGGCTGTTGG + Exonic
903715405 1:25362534-25362556 CAGTTTCCTCATTTGGCTGTTGG - Exonic
904318640 1:29682296-29682318 CAGTTTCCTCATCTGTGGGTGGG + Intergenic
904355892 1:29939589-29939611 CAGTTTCCTCATTCGTGGGTGGG - Intergenic
904396421 1:30225306-30225328 CAGTTTCCTTAGGGGCAGGTGGG - Intergenic
904438851 1:30516713-30516735 CAGTTTCCTCATTTGTGGGTGGG - Intergenic
905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG + Intergenic
905514999 1:38556146-38556168 CAGATTCCTCAGAGGGAAGTCGG + Intergenic
907245389 1:53105389-53105411 CAGTTTCCTCTTCAGGAAGTGGG + Intronic
907565861 1:55432632-55432654 CAGTTTCTTCATAGGTTCGTTGG - Intergenic
907831923 1:58072487-58072509 CAGTTTCCTCATATGCAAGATGG + Intronic
908398538 1:63748463-63748485 CAGTTTCCTCATTTGAAGCTGGG - Intergenic
908809608 1:67966553-67966575 CAGTGTCCTCACAGGGTGGAAGG - Intergenic
908939340 1:69412415-69412437 CAGTTTCCTCACTGGGAAATTGG + Intergenic
910440413 1:87246167-87246189 CACTTACCTCATAGGATGGTGGG + Intergenic
910837415 1:91529730-91529752 CAGTTTCCTCATCTGGAAATGGG + Intergenic
911467374 1:98272531-98272553 CAGTTTCCTCACAAGGTGGAAGG - Intergenic
911938367 1:104010249-104010271 CAGTTTCTTCATAGTGTCGTTGG + Intergenic
912032350 1:105264856-105264878 CAGTTTCTTCATAGTGTTGTTGG + Intergenic
912894660 1:113574272-113574294 CAGTTTCTTCATAGGGTTGTTGG + Intronic
913276136 1:117139962-117139984 CAGTGTCCTCACAGTGAGCTAGG + Intergenic
915301016 1:154951708-154951730 CAGTTTCCTCAGAGAAAGGGAGG - Intronic
917454374 1:175173459-175173481 CAGTTTCCTCATCTGTAGGATGG - Intronic
917482081 1:175420885-175420907 TGGTTTTCTCATAGGGAGATTGG + Intronic
917727414 1:177840775-177840797 CAGTTTCATCATCTGTAGGTGGG - Intergenic
918088262 1:181263758-181263780 CAGTTTCCTCATCTGAAAGTGGG + Intergenic
918246065 1:182660577-182660599 CAGTTTCCACATATGTAGGGAGG - Intronic
918740836 1:188128575-188128597 CAGTTTCCTCACAGGAAGGGTGG - Intergenic
918847443 1:189636355-189636377 TAATTTCCTAATAGGCAGGTGGG + Intergenic
919250751 1:195053782-195053804 CAGTTTCCTCATAGTAAAATGGG + Intergenic
922194353 1:223346657-223346679 CAGTTTCCTCATATGAAAATAGG + Intronic
922384177 1:225065001-225065023 CAGTTTCCTCAAAGGTAAATTGG + Intronic
923694031 1:236228764-236228786 CAGTTTCCTCATCTGGAGCGTGG - Intronic
924152289 1:241141546-241141568 CATCTTCCTCATAGGGTGGCAGG + Intronic
924640250 1:245826773-245826795 CAGCTTCCTCACAGGGCGGCAGG + Intronic
1062769588 10:88241-88263 CAGTTTCCTCATCTGCAGGAGGG - Intergenic
1063203472 10:3807931-3807953 CAGTTTCCTCATTGGTAGCATGG + Intergenic
1064688007 10:17884354-17884376 GAGATTCCTCCTGGGGAGGTGGG - Intronic
1064758077 10:18589821-18589843 CAGTTTCTTCATAGTGTCGTTGG - Intronic
1065907854 10:30274172-30274194 CAGTTTCTTCATAGTGTTGTTGG - Intergenic
1068835804 10:61552090-61552112 CAGTTTCTTCATAAGGTCGTTGG - Intergenic
1071523311 10:86344291-86344313 CAGTTTCCTCATCTGTAGGATGG - Intronic
1072127822 10:92462745-92462767 CAGTTTCCTCATCTGGAAATTGG + Intronic
1072158786 10:92747439-92747461 CAGCTTCCTCATTGGGAAGATGG + Intergenic
1073790483 10:106935119-106935141 CAGTTTCCTCATTTGTAAGTGGG - Intronic
1074181737 10:111071242-111071264 CAGTTTCCTCATATGGAAAAAGG - Intergenic
1074187206 10:111107534-111107556 CAGTTTCCTCATCTGGTGGATGG + Intergenic
1074242771 10:111655336-111655358 CAGTTTCATTCTAGGGAAGTTGG + Intergenic
1074363427 10:112839967-112839989 CAGTTTCCTCATCTGTAAGTTGG + Intergenic
1074461082 10:113637275-113637297 CAGTTTCCACATTGTAAGGTAGG - Intronic
1075983696 10:126765126-126765148 CAGTTTCCTCATAGTGTTGGTGG + Intergenic
1076699654 10:132264784-132264806 GAGTTTCCTCGGTGGGAGGTGGG + Intronic
1077718326 11:4603041-4603063 CAGTTTCTCCATGGGGATGTAGG - Intronic
1078560014 11:12363334-12363356 ATGTTTCCTCTTAGGGAGGAAGG - Intergenic
1080026757 11:27623242-27623264 CAGTTTCCTCATCTGGAAATAGG + Intergenic
1080849756 11:36057945-36057967 CAGTTTTCTCATCTGGAGGAGGG + Intronic
1081244225 11:40744684-40744706 CAGTTTCCTCATAGTAAGATGGG - Intronic
1081941991 11:46951046-46951068 CAGTTTCCTCAAAGAAAAGTGGG - Intronic
1083222504 11:61262276-61262298 CAGTTTCCCCAGGTGGAGGTAGG + Intronic
1083475341 11:62911668-62911690 CAGTTCCCTCACAGTGAGATGGG - Intronic
1083615331 11:64023363-64023385 CAGTTTCCTCATCTGTAGGGGGG + Intronic
1083951578 11:65959455-65959477 TAGTTTCCTCATTGAGAAGTAGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084739023 11:71126566-71126588 CAGATTCCTCAGATGGAGCTGGG + Intronic
1085235810 11:75014511-75014533 CAGTTTCCTGATTTGCAGGTTGG - Intronic
1086732614 11:90269142-90269164 CAGTTTCCTCATAGCGTTGATGG + Intergenic
1087146554 11:94819090-94819112 CAGTTTACTCCTAGAAAGGTAGG - Intronic
1090931402 11:131300957-131300979 CAGTTTCCTTATTGGGAAATGGG + Intergenic
1091242794 11:134065329-134065351 CTGTTTCCTTAGAGGGAGGTGGG + Intergenic
1091770280 12:3146959-3146981 CAGTTTCCTCATCGGAAAATGGG + Intronic
1092826361 12:12403486-12403508 CAGTTTCCTCAGAAGCAGGAAGG - Intronic
1094429062 12:30346854-30346876 CAGCTTCCTCATAGGGAAAATGG - Intergenic
1096245036 12:49979863-49979885 CACTTTCCTCATCTGGAGGATGG + Intronic
1096525313 12:52206899-52206921 CAGTTTCCTTACAGAGAGGGAGG + Intergenic
1096668756 12:53185124-53185146 ATGCTTCCTCATAGGGAAGTGGG + Intronic
1097785660 12:63756042-63756064 CAGTTTCCTCATTTGTAAGTTGG + Intergenic
1097898584 12:64851602-64851624 CAGTTTCTTCATAGTGTTGTTGG + Intronic
1098670835 12:73228928-73228950 CACCTTCTTCATAGGGAGGCAGG + Intergenic
1098706478 12:73697711-73697733 CAGTTTCTTCATCAGGAAGTGGG - Intergenic
1099283054 12:80676905-80676927 CAATTTCCTCATCTGGGGGTGGG - Intronic
1100134049 12:91533161-91533183 CTGTGTCCTCATAGGGTGGAAGG - Intergenic
1100301747 12:93314358-93314380 CAGTTTCCTCATCTGTAAGTGGG + Intergenic
1100358181 12:93851440-93851462 CAGTTTCCTCATTGGCAGAATGG + Intronic
1100900990 12:99239980-99240002 CAGTTTCCTCATAGCGTTGATGG - Intronic
1101925360 12:108967042-108967064 CAGTTTTCTCATCTGTAGGTGGG - Intronic
1101953039 12:109191088-109191110 CAGTTTCCTCATATGGAAAATGG - Intronic
1102000028 12:109551653-109551675 CAGTTTCCTCATCTGTAAGTTGG + Intergenic
1102461878 12:113104955-113104977 CAGTTTTCTCATCTGCAGGTTGG - Intronic
1102470584 12:113157782-113157804 CCGTTTCCTCATTGGGAAGATGG + Exonic
1102609068 12:114095349-114095371 CAGGTTTCTCAGAGGAAGGTGGG + Intergenic
1103002349 12:117394898-117394920 CAGTTTCCTCATCTGTAAGTTGG + Intronic
1103250418 12:119495097-119495119 CAGTTTCCTTATTGGTAAGTTGG - Intronic
1103946934 12:124532078-124532100 CAGTTTCCTCATCTGGAGAATGG + Intronic
1106676126 13:31960268-31960290 CAGTTTCCTCATTGTGAAATGGG - Intergenic
1107172759 13:37362641-37362663 CAGTTTCCTCCTATGAAGGATGG - Intergenic
1107464510 13:40637006-40637028 CAGTTTCCTCATTTGTAAGTTGG - Intronic
1109418752 13:62080584-62080606 CATTTTCTTCACAAGGAGGTAGG - Intergenic
1111772160 13:92610744-92610766 CACTTTCCTCACAGGGTGGCAGG + Intronic
1113601962 13:111575840-111575862 CTGTGTCCTCATATGGGGGTAGG + Intergenic
1115456055 14:33603621-33603643 CAGATTTCTCATAGGAAGTTGGG + Intronic
1115651688 14:35406670-35406692 CAGTTTCTTTTTAGGGAAGTAGG - Intergenic
1117121292 14:52570409-52570431 CAGTTTCTTCATAGGGTCGATGG - Intronic
1117720247 14:58622242-58622264 CAGTTTCCTCCTAGAGCTGTTGG + Intergenic
1118507624 14:66430796-66430818 CAGTTTTCTCATTAGGATGTTGG + Intergenic
1119866241 14:77977533-77977555 CAGTTTCCTCATAAGTAAATGGG + Intergenic
1119896851 14:78227321-78227343 CAGTTTCTTCATAGGTAGATGGG + Intergenic
1120997802 14:90429693-90429715 CAGTTTCTTCATAGGAATATTGG - Intergenic
1121046881 14:90794595-90794617 GAGTTTCCTGCTAGGCAGGTAGG + Intronic
1121207922 14:92185041-92185063 CAGATTCCTGATTGGGAGGTAGG - Intergenic
1121243835 14:92448894-92448916 CAGTTTCCTGACAGGGACCTGGG - Intronic
1121276359 14:92670718-92670740 CAATTTCCTCACAGTGTGGTTGG + Intronic
1121520330 14:94581697-94581719 CCGTTTCCTCATAGGTAAGATGG + Exonic
1121779593 14:96613817-96613839 AAGTGTCCTCATAGGGTGGATGG - Intergenic
1124013898 15:25860775-25860797 CAGTTTCCTCATCGGCAAGATGG + Intronic
1125643495 15:41251234-41251256 CAGTTTCTTCATCTGGAGGCTGG - Intronic
1127390363 15:58500248-58500270 CAGTTTCCTCGTAGGTAAGGTGG + Intronic
1128120241 15:65140676-65140698 CTGTTTCCTCATAGGGTTCTGGG - Intergenic
1128463100 15:67886260-67886282 CAGTTTCCTCTTTGTGAAGTGGG + Intergenic
1129385465 15:75193822-75193844 CAGTTTCCTCATTGAGAAGTGGG - Intergenic
1129464315 15:75715426-75715448 CAGTTTCCTCATCTGGAAGCAGG - Intergenic
1129720932 15:77877586-77877608 CAGTTTCCTCATCTGGAAGCAGG + Intergenic
1129974906 15:79813884-79813906 CAGTTTCCTCATCTGTAAGTGGG - Intergenic
1130017732 15:80200663-80200685 CAGTTTCCTCATTGTAAGATAGG - Intergenic
1130894238 15:88158090-88158112 CAGTTTGCTCATCTGGAAGTTGG + Intronic
1131629507 15:94161487-94161509 CAGGTGCCTCAGTGGGAGGTGGG - Intergenic
1132317666 15:100901622-100901644 CAGTTTCCTCATCTGGAGAGTGG + Intronic
1133107087 16:3519041-3519063 CAGATTCCTCATAAAGAGATTGG + Intronic
1133300484 16:4779485-4779507 CAGTTTCCTCACAGTAAAGTGGG - Intronic
1133881500 16:9786790-9786812 CAGTTTCCTCATATGTAAATAGG + Intronic
1133912055 16:10075136-10075158 CAGTTTCCTCATCTGCATGTCGG + Intronic
1134296841 16:12953844-12953866 CAGCTTCTTCATAAGGTGGTAGG + Intronic
1135905807 16:26510758-26510780 CAGTTTCCTCATCTGGAAATGGG + Intergenic
1137832399 16:51556547-51556569 CAGTTTCTTCACATGCAGGTTGG - Intergenic
1138423219 16:56913264-56913286 CACTTTGCCCATAGGGAGGAAGG + Exonic
1138625669 16:58249628-58249650 CAGTTTCCTTATTGGGAGAATGG + Intronic
1139953226 16:70681765-70681787 GGGTTTCCCAATAGGGAGGTCGG + Intronic
1142887546 17:2922192-2922214 CAGTGTCCTCACAGGGAGGAAGG + Intronic
1143248377 17:5504264-5504286 CAGTTTCCTCATTGGAACATTGG - Intronic
1143522113 17:7450467-7450489 CAGTTTCCTGATCTGGAAGTGGG + Intronic
1143700755 17:8658353-8658375 CAGTTTCCTCATCTGTATGTTGG + Intergenic
1144966516 17:19079970-19079992 CAGTTTCCTCCTTTGTAGGTGGG + Intergenic
1144981402 17:19172087-19172109 CAGTTTCCTCCTTTGTAGGTGGG - Intergenic
1144986822 17:19206152-19206174 CAGTTTCCTCCTTTGTAGGTGGG + Intergenic
1145875361 17:28315081-28315103 CAGTTTCCTCATGAGGTGTTAGG + Intergenic
1145899897 17:28483731-28483753 CAGTTTCCTCATCTGGAAATGGG - Intronic
1148402986 17:47384388-47384410 CAGTTTCTTCATAGTGTGATTGG + Intronic
1148804424 17:50257205-50257227 CAGCTTCTCCACAGGGAGGTAGG - Intergenic
1149707466 17:58707880-58707902 CTGTGTCCTCATGGGGAGGAAGG + Intronic
1150055446 17:62010737-62010759 CAGCTTCCTGATATTGAGGTGGG + Exonic
1150465937 17:65392677-65392699 CAGTTTCCTCATATGTAGAAAGG - Intergenic
1150647680 17:66989798-66989820 CAGTACCCACATTGGGAGGTTGG - Intronic
1152091223 17:78248960-78248982 CTGTTTCCTCATTGTGAAGTAGG + Intergenic
1152131438 17:78479305-78479327 CAATTGCTTCATGGGGAGGTAGG - Intronic
1152162836 17:78679776-78679798 CAGTTTCCTCATCTGTAGCTAGG + Intronic
1153943484 18:9997095-9997117 CAGTTTCCTGAGAGGGAAGCTGG - Intergenic
1155737653 18:29243880-29243902 CAGTCCCCTCATATGGAGGGAGG + Intergenic
1156034764 18:32753937-32753959 CAACTTCCTCACAGGGATGTGGG - Intronic
1156188166 18:34688220-34688242 CAGTTTCTTCATAGTGTGGATGG + Intronic
1157514801 18:48303317-48303339 GAGTCTCATCAGAGGGAGGTTGG - Intronic
1160257608 18:77260385-77260407 CTGTGTCCTCATAGGGTGGGAGG + Intronic
1160583732 18:79901486-79901508 CAGTTTCCTCATGGGGTGAGGGG + Intergenic
1161217088 19:3099934-3099956 CAGTTTCCTCAGGGGGCGGTGGG + Intronic
1161758431 19:6152148-6152170 CAGTTTCCTCATCTGTAGATAGG - Intronic
1162846754 19:13398690-13398712 CAGTTTCCTCATAGGGAGGTTGG + Intronic
1163626435 19:18392593-18392615 CAGCCTCCTCAGAGAGAGGTGGG - Intronic
1163727054 19:18928806-18928828 CAGTTTCCTCATCTGGAGAATGG + Intronic
1164957934 19:32403217-32403239 CACTTTCCTCACAAGGAGGCAGG + Intergenic
1165486846 19:36101561-36101583 CAGTTTCCCCATCTGGAGGAGGG - Intronic
1165805171 19:38576093-38576115 CAGTTTCCCCATGGGGAGATGGG + Intronic
1166125024 19:40709956-40709978 CAGTTTCCTCATGCGGAAGATGG - Intronic
1166779857 19:45336041-45336063 CAGTTTCCTCATTTTTAGGTGGG + Intronic
1166904608 19:46098900-46098922 CAGTTTCTTCATAGTGTCGTTGG + Intergenic
1168546115 19:57251359-57251381 CATTTTCCTCATTGGTAGGGTGG + Intronic
925728895 2:6902900-6902922 CAGTTTCTTCATAGTGTTGTTGG + Intergenic
926703380 2:15819091-15819113 CAGTTTCCTCCTCTGGATGTGGG + Intergenic
926842697 2:17100155-17100177 AAGATTACTCATAGAGAGGTAGG - Intergenic
926970427 2:18462292-18462314 CACTTTCTTCATAGGGATGATGG + Intergenic
927448783 2:23188630-23188652 CAGTTTCCTAACTGTGAGGTGGG - Intergenic
927839919 2:26434337-26434359 CAGTTTTCTTTTAGGGTGGTGGG - Intronic
929028705 2:37630152-37630174 CACTTTCACCATGGGGAGGTGGG - Intergenic
929062696 2:37939960-37939982 CAGTTTCTTCATAGTGTGGATGG + Intronic
930440104 2:51393554-51393576 CAGTTTCTTCATAGGGTTGATGG - Intergenic
931083950 2:58808051-58808073 AAGTTTCCTCACAGGCCGGTGGG - Intergenic
931233213 2:60391618-60391640 CAGTTTCCTTATAGGTAAGCTGG + Intergenic
932075749 2:68660844-68660866 CTGTTTCCTCATCTGTAGGTGGG - Intergenic
933237499 2:79881885-79881907 CAGTTTCTTCATAGAGTCGTTGG + Intronic
935961694 2:108431424-108431446 CAGTTTCTTCATAGTGTGGATGG - Intergenic
936632627 2:114220323-114220345 CAGTTTCCTCCAATGGTGGTAGG + Intergenic
937143364 2:119620655-119620677 CAGTTTCCTCATAGTGTTGATGG - Intronic
939224667 2:139349889-139349911 CAGTTTCTTCATAGTGATGATGG - Intergenic
939588319 2:144032248-144032270 CAGTTTCCTCATAGGCAAAATGG + Intronic
939840816 2:147184450-147184472 CAGTTTCTTCATAGTGTCGTTGG - Intergenic
940588458 2:155687083-155687105 CAGCTTGCTCATAGGGCGATGGG - Intergenic
941205103 2:162562424-162562446 CAGATCCCTAATATGGAGGTTGG + Intronic
941478259 2:165973820-165973842 CAGTTTCTTCATAGTGTCGTTGG - Intergenic
941660104 2:168187472-168187494 CAGTTTCCTCATTGGTAAGACGG + Intronic
943147479 2:184064211-184064233 CAGTTTCTTCATAGTGTCGTTGG + Intergenic
943308566 2:186298254-186298276 CACTTTCCTCACAAGGAGGAAGG - Intergenic
943630086 2:190241541-190241563 CAGTTTCTTCATAGTGTTGTTGG + Intronic
943720521 2:191199198-191199220 CCGTCTCCTCATATGGAAGTAGG - Intergenic
944583363 2:201152400-201152422 GACCTACCTCATAGGGAGGTTGG + Intronic
944608151 2:201371693-201371715 CAGTTTCTTCATAGTGACGATGG - Intergenic
944752631 2:202726712-202726734 CAGTTTCCTCATGTGAAGATGGG + Intronic
945481354 2:210349627-210349649 CAGTTTCTTCATAGTGTTGTTGG + Intergenic
946928452 2:224648676-224648698 CAGTTTCCTCATTCGGAAATTGG - Intergenic
947435836 2:230071277-230071299 GAGTTTCAGCATATGGAGGTAGG + Intergenic
947765537 2:232634759-232634781 CAGTTTCCTCATCTGGAGAGTGG + Intronic
948108501 2:235434828-235434850 GCCTTTCCTGATAGGGAGGTTGG - Intergenic
948948456 2:241233827-241233849 CAGTTTCCTGATAAGGACGATGG - Exonic
1168825385 20:809711-809733 CAGTTTATTCATAGACAGGTAGG - Intergenic
1170586195 20:17735833-17735855 CATTTTCCCCAGAGGGTGGTGGG - Exonic
1171427157 20:25056634-25056656 CAGTCTCCTCATTGTGAGGATGG - Intronic
1172073059 20:32272770-32272792 GAGTTTGCTCTTGGGGAGGTAGG + Intergenic
1172229989 20:33330148-33330170 CAGTTTCCTCATCTGTAAGTGGG - Intergenic
1172478978 20:35259922-35259944 CACCTTCGTCATAGGGATGTGGG - Intronic
1172561705 20:35894710-35894732 CAGTTTCCTCATGTGCAGGATGG - Intronic
1172636800 20:36415602-36415624 CAGTGTCCTCAAAGGGTTGTTGG - Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173537918 20:43829958-43829980 CAGTTTCCTCATATGTAGGAAGG + Intergenic
1173817953 20:46002038-46002060 CAGTTTCCTCATCTGGAAATGGG + Intergenic
1173908235 20:46644355-46644377 CAGTTTTCTCATCTGGAGATTGG - Intronic
1175218356 20:57403244-57403266 CAGTTTCCTCATCTGTAAGTTGG - Intronic
1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG + Intergenic
1176076422 20:63250395-63250417 CAGTTTCCTCATCTGGAGAATGG + Intronic
1177042472 21:16131277-16131299 CAGTTTCCTCATAGTGTCGATGG + Intergenic
1177935108 21:27335377-27335399 CAGTTTCCTACTAGGGATGCAGG + Intergenic
1179547900 21:42124678-42124700 CATTGTCCTCATCGGGAGCTAGG + Intronic
1179982847 21:44905547-44905569 CAGTTTCCTCACTGTGAAGTGGG + Intronic
1180391151 22:12283504-12283526 CTGTTTCCTCATATGGTGGAAGG + Intergenic
1181450984 22:23020523-23020545 CAGTTTCCTCACATGGTGGAAGG - Intergenic
1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG + Intergenic
1182102925 22:27670517-27670539 CAGTTTCCTCATTTGGATGATGG - Intergenic
1182133634 22:27879478-27879500 CACTCTCCTCAGGGGGAGGTGGG + Intronic
1182488551 22:30654465-30654487 CTTTTTCGTCATAGGGTGGTGGG + Intronic
1182579579 22:31298000-31298022 CAGTTTCCTCATATGGAGGGAGG + Intergenic
1183716263 22:39535276-39535298 CAGTTTCCTCATTGGTTGGATGG + Intergenic
1184039217 22:41933388-41933410 CTGTGTCCTCACAGGGAGGCTGG + Intergenic
949554049 3:5137146-5137168 CAGTTTCCTCATTGGGGATTTGG + Intronic
949714232 3:6910046-6910068 CAGCTTCCTCATTGGGGAGTTGG + Intronic
949957934 3:9285429-9285451 GAGTCTCCTCACAGGTAGGTTGG - Intronic
950898849 3:16478334-16478356 CAGTTTCCTTATTGGGAGATGGG - Intronic
951217233 3:20036999-20037021 CACTTCCCTCAGAGGAAGGTTGG + Intergenic
951347007 3:21559243-21559265 CAGTTTCCTCATAGTGTCGATGG + Intronic
953911804 3:46896964-46896986 CCATTTCCTCATTGGGAAGTTGG - Intronic
954507937 3:51095238-51095260 CAGTTTCTTCATAGTGTGGATGG + Intronic
955730896 3:61985274-61985296 AAGTTCCCTCCTGGGGAGGTGGG + Intronic
955831911 3:63014120-63014142 CAGTTTCTTCATAGTGTCGTTGG + Intergenic
955855136 3:63264793-63264815 CACTTTCCTCACAGGGTGGAAGG + Intronic
956002841 3:64747493-64747515 CAGTTTCCTCTCTGGGAGGTAGG - Intergenic
956095543 3:65712273-65712295 CAGTTTCCTCAGAGCATGGTGGG - Intronic
956964784 3:74446178-74446200 CAGTTTCCTCATATGTAAGATGG + Intronic
957310621 3:78513846-78513868 CAGTTTCCTCATATGTAAGTTGG - Intergenic
957696625 3:83648225-83648247 CAGTTTCTTCATAGTGTCGTTGG + Intergenic
959617850 3:108368271-108368293 CAGTTTCCTCATAGTGTTGTTGG - Intronic
960999126 3:123360905-123360927 CAGTTTCCTCATTGGCAGAGGGG - Intronic
961096622 3:124162128-124162150 CAGTTTCCTAAGAGGGGGTTGGG + Intronic
961467447 3:127090356-127090378 CAGTCTCCTGAGAGGGAGGAGGG - Intergenic
961749543 3:129087244-129087266 CGCTTCCCTCATGGGGAGGTCGG + Intergenic
962064597 3:131965287-131965309 CAGTTTCTTCATAGTGTTGTTGG - Intronic
962577858 3:136771102-136771124 CTGTGTCCTCATATGGAGGAAGG - Intergenic
963532212 3:146484853-146484875 CAGTTTCCTCATAGTGTCATTGG - Intronic
963976526 3:151485864-151485886 CAGTTTCTTCATAGTGTGGATGG - Intergenic
964007557 3:151850346-151850368 CAGTTTCTTCATAGTGATATTGG + Intergenic
965028901 3:163337423-163337445 CATTTTCTTCATAGGGAATTAGG - Intergenic
965880676 3:173384214-173384236 CAGTTTCCTCATAGTGTTGATGG - Intergenic
966120487 3:176514178-176514200 TAGTTTCCTTAAAGGGATGTGGG + Intergenic
966177796 3:177158023-177158045 AGGTTTGCTCATAGGTAGGTTGG + Intronic
966211124 3:177454536-177454558 CAGTTTCCTCATCTGTAAGTGGG - Intergenic
967520755 3:190429609-190429631 CAATTTCTTCATATGGAGGTGGG + Exonic
968546284 4:1200634-1200656 CAGCTTCCTGCTAGGGAGATGGG - Intronic
968682388 4:1929984-1930006 CAGATTCCTGGTAGGCAGGTTGG + Intronic
969058026 4:4414132-4414154 CAGGTTCCCCACAGGGAGGAGGG + Intronic
969418082 4:7074051-7074073 CAGTTTACTGACAGTGAGGTGGG - Intergenic
969672333 4:8596665-8596687 CAGTTTCCTCATGTGTAGATTGG - Intronic
972094963 4:35337095-35337117 CAGTTTACCTATAGGTAGGTAGG + Intergenic
972359410 4:38313788-38313810 CAGTTTCCTCATTGGAAAATGGG + Intergenic
972850958 4:43050045-43050067 CATTTTCTTGTTAGGGAGGTGGG - Intergenic
976819594 4:89190433-89190455 CAGTTTATTCATAGTGTGGTTGG + Intergenic
979607826 4:122657740-122657762 CAGTTTCCTCATCTGGAGAATGG + Intergenic
980336088 4:131475270-131475292 CAGTTTCTTCATAGTGTTGTGGG - Intergenic
980959561 4:139461439-139461461 CAGTTTCCTCATCTGAAGATTGG + Intronic
981133768 4:141187925-141187947 CAGTTTCTTCATAGTGTTGTTGG + Intronic
981959884 4:150523742-150523764 GACTATCCTCAGAGGGAGGTGGG + Intronic
983514696 4:168643857-168643879 CAGTTTCCTAATCGGGAAGTAGG - Intronic
983558372 4:169078019-169078041 GAGTTTCCTCATAGCTTGGTTGG - Intergenic
984484847 4:180354993-180355015 CAATTTCCAAATAGGGTGGTAGG + Intergenic
985091554 4:186367910-186367932 TACTTACCTCATAGGGAGGGTGG - Intergenic
986763829 5:10904756-10904778 CAGTTTCCTCATAGGAAAAATGG + Intergenic
987399612 5:17462080-17462102 CAGTTTCCTCATAGTGTCATTGG + Intergenic
987656740 5:20816668-20816690 CAGTTTCTTCATAGTGACGATGG - Intergenic
988018767 5:25596555-25596577 CACCTTCTTCATAGGGAGGCAGG + Intergenic
989550000 5:42723479-42723501 CAGTCTACTCAGAGGGATGTAGG - Intergenic
990414637 5:55574597-55574619 CAGTTTCCTCATATGAATATAGG + Intergenic
991256071 5:64616401-64616423 CAGTTTCCTCATAGTAAAATGGG + Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993977099 5:94496100-94496122 CAGTCCCCTCAAAGAGAGGTTGG + Intronic
994170657 5:96656631-96656653 TTCTTTCCTCATTGGGAGGTGGG - Intronic
995026509 5:107429638-107429660 CAGTTTCCTCATATGTAAGTTGG + Intronic
995475248 5:112541019-112541041 CAGTTTCCTCATAGTGTCGATGG - Intergenic
995885251 5:116887437-116887459 CAGTTTCCTCATCTGGAAATGGG - Intergenic
996280478 5:121724448-121724470 CAGTTTCTTCATAGTGTCGTTGG + Intergenic
997349350 5:133219360-133219382 CAGTTGTCTCATAGGCAAGTTGG - Intronic
998503077 5:142650452-142650474 CAGTTTCCTCATCGGCAGAAGGG + Intronic
998755413 5:145374061-145374083 CAGTTTCTTCATAGTGTGATTGG + Intergenic
999121737 5:149215024-149215046 CAGTTTGAGCAAAGGGAGGTAGG - Intronic
999322707 5:150625071-150625093 CAGTTTCCCCATCTGTAGGTGGG + Intronic
999502160 5:152158366-152158388 CAGTTTCTTCATAGTGTCGTTGG + Intergenic
999819701 5:155214034-155214056 CAGTTTCCTCATATGTAAATTGG + Intergenic
1000095871 5:157970400-157970422 CAGTTTCCCCATACGGAGAATGG + Intergenic
1001010255 5:168091066-168091088 CAGTTTCCTCATAGTAAAATAGG + Intronic
1001057015 5:168458056-168458078 CAGCTTCATCAGTGGGAGGTTGG + Intronic
1002309268 5:178304812-178304834 CAGTTTCCTCATCAGCAAGTGGG + Intronic
1004222921 6:13761898-13761920 CAATTTCCTCCTGGGGAGTTGGG + Intergenic
1005425063 6:25693910-25693932 CAGTTTCCTCATCTGGAAGATGG + Intronic
1006200219 6:32281590-32281612 CAGTTTCTTCATAGTGTCGTTGG - Intergenic
1007095056 6:39207889-39207911 CAGCTTCCTCCCAGGGAGGTAGG - Intronic
1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG + Intronic
1009032607 6:58078237-58078259 CAGTTTCCTCCTTTGGAGGATGG - Intergenic
1009338710 6:62526920-62526942 CTGTTTCCTCATATGGTGGAAGG - Intergenic
1009798406 6:68502318-68502340 CAGTTTCCCCATTGGGCGGGGGG - Intergenic
1010400007 6:75437565-75437587 CAGTTACCTCATAGTGAGCAAGG - Intronic
1012514274 6:100040384-100040406 CAGTTTCCTCATAGTGTTGATGG - Intergenic
1015433005 6:133153146-133153168 CAGTTTCTTCATAGTGTCGTTGG + Intergenic
1016458013 6:144251295-144251317 CAGTGTCCTCAGAGGGAGCATGG - Intergenic
1016872201 6:148829377-148829399 CATTTTCCAGATAGGGAAGTTGG - Intronic
1017244257 6:152205439-152205461 CAGTTTCCTCATCGGTAGAGTGG - Intronic
1018110238 6:160529901-160529923 CAGTTTCTTCATAGTGTGGATGG - Intergenic
1018395907 6:163377894-163377916 CAGCTTTCTCAGTGGGAGGTTGG - Intergenic
1018923007 6:168188786-168188808 CAGTGTCCTCAGTGGGAGGATGG + Intergenic
1019818156 7:3216659-3216681 CAGTTTCCTCATATAAAAGTGGG + Intergenic
1022727242 7:32992289-32992311 CAGTTTCCTCTGAGGGGGGTGGG - Intronic
1022773518 7:33500483-33500505 CTGTTTCCTCATCGGGAAGTGGG + Intronic
1022807230 7:33834547-33834569 CAGTTTCCTCATCTGAAAGTGGG - Intergenic
1023894510 7:44420912-44420934 CAGTTTCTTCATAGTGTTGTTGG - Intronic
1023999456 7:45181135-45181157 CAGTTTCCTCATCTGTAAGTGGG - Intronic
1025046338 7:55695340-55695362 CAGTTTCCTCTGAAGGGGGTGGG + Intergenic
1025838920 7:65125005-65125027 TAGTTGCCTCATAGAGCGGTTGG + Intergenic
1025884146 7:65570960-65570982 TAGTTGCCTCATAGAGCGGTTGG - Intergenic
1025889297 7:65631646-65631668 TAGTTGCCTCATAGAGCGGTTGG + Intergenic
1027702927 7:81491285-81491307 CAGTTTCCTCATATGTAAATAGG - Intergenic
1027884128 7:83881311-83881333 CAGCTTCTTCATAGGGCGGCAGG + Intergenic
1029014691 7:97303555-97303577 CAGTTTCCTCATAGGAATGTTGG + Intergenic
1033563996 7:142561029-142561051 CTTTTTTCTCATAGGGAGGGAGG - Intergenic
1033589112 7:142796038-142796060 CAGTTTCCTCATTGGAAAGATGG - Intergenic
1035998092 8:4572195-4572217 CAGTTTCTTCATAGTGTTGTTGG + Intronic
1036800090 8:11784409-11784431 CAGTTTCCTCATCTGAAGGAAGG - Intronic
1036953936 8:13166953-13166975 CATTTTCATCATAGGGAAATGGG - Intronic
1037653847 8:20866147-20866169 AAGTTTACTCATGCGGAGGTGGG - Intergenic
1037917382 8:22780958-22780980 CAGTTTCCTCAGCTGGAGATGGG - Intronic
1038037777 8:23701366-23701388 CATTTTACTCATAGGGACATGGG - Intergenic
1038512599 8:28153508-28153530 CAGTTTCGTCATAGGTAGGGAGG + Intronic
1040888773 8:52293714-52293736 CAGTTTCCTCATTGGTAAATGGG + Intronic
1040948759 8:52914371-52914393 TAGTTTCCTCATCTGGAGGATGG + Intergenic
1041383349 8:57275194-57275216 CAGTTTCTTTACTGGGAGGTTGG - Intergenic
1042626961 8:70769007-70769029 CAGTTTCTTCATAGTGTCGTTGG + Intronic
1043587291 8:81783916-81783938 CAGTTTCACTGTAGGGAGGTGGG + Intergenic
1043882069 8:85555335-85555357 CAGTTTCCTCATATGCAAATTGG - Intergenic
1045242974 8:100418413-100418435 CAGTTTCCTCATCTGTAGATGGG + Intergenic
1046628636 8:116601869-116601891 CAGTTTCCTCATCTGTAGATGGG - Intergenic
1048011352 8:130458981-130459003 CAGTTTCCTCATATGTAGAATGG + Intergenic
1048815232 8:138327324-138327346 CAGGTTCCTCATAGGAATATTGG - Intronic
1049079129 8:140427965-140427987 CAGTCTCCCCATAGGCAGGGAGG - Intronic
1049315154 8:141962039-141962061 CAGTTTCCTCCTTGGAAAGTTGG - Intergenic
1049472415 8:142782422-142782444 TAGTTTCCCCATACGGAAGTGGG + Intergenic
1050302512 9:4274083-4274105 CAGTTTCCTCATCTGGAAGGTGG - Intronic
1050982533 9:12037892-12037914 CAGTTTCTTCATAGTGACATTGG - Intergenic
1051451474 9:17202914-17202936 CAGTTTCTTCATAGTGTCGTTGG + Intronic
1053340515 9:37323061-37323083 CAGTTTCCTCATAGGTAAAACGG - Intronic
1055065837 9:72117425-72117447 CAGTCTCTTCATTGGGAGATGGG - Intronic
1056801350 9:89694265-89694287 CAGTTTCTGCATTGGTAGGTAGG - Intergenic
1058260019 9:102816438-102816460 CAGTTTCTTCATAGGGTCATTGG - Intergenic
1058266007 9:102899493-102899515 CAGTTTCTTCATAGCGTCGTTGG - Intergenic
1059439933 9:114301216-114301238 CAGTTTCCTCATCTGGAAATGGG + Intronic
1059739209 9:117133287-117133309 CAGTCACCTCACAGGGAGGCTGG - Intronic
1060808146 9:126591453-126591475 CAGTTTCCTCATCAGTAAGTTGG - Intergenic
1060894420 9:127208529-127208551 CAGTTTCCTCATTGTGGGGACGG + Intronic
1061052674 9:128205432-128205454 CAGTTTCCTCATCTGTAGGATGG - Intronic
1061060366 9:128247203-128247225 CAGTTTCCTCACTGGGAAGATGG - Intronic
1061206576 9:129167329-129167351 CAGTCTCCTCAAAGGAAGCTGGG - Intergenic
1061236451 9:129345876-129345898 CAGTTTTCTCATGGGGAAATGGG + Intergenic
1061371399 9:130199590-130199612 CAGTTTCCACATTTGGAGCTGGG + Intronic
1061536228 9:131252010-131252032 CGCTTTCCTCACAGGGAGGAGGG - Intergenic
1062219743 9:135408833-135408855 CAGTTTCCTCAGATGGAGAATGG - Intergenic
1062459434 9:136656723-136656745 CAGTTTCCTCATCTGTAGATGGG + Intergenic
1186812946 X:13207940-13207962 CAGTTTCCTCTTGGAGATGTGGG + Intergenic
1188623561 X:32256590-32256612 CAGTTTCTTCATAGGGTCGATGG + Intronic
1189978214 X:46484146-46484168 CAGTTTCTTCATAGGGTTGGTGG + Intronic
1190731358 X:53228198-53228220 CAGTTTCCTCATCTGTAGGATGG - Intergenic
1190827253 X:54028938-54028960 CAGTTTCCTCATTGTAAGATGGG + Intronic
1190924461 X:54889582-54889604 CAGTTTCTTCATAGTGTCGTTGG - Intergenic
1190943742 X:55071112-55071134 CAGTTTCTTCATAGCGTTGTTGG + Intergenic
1191787349 X:64930694-64930716 CAGTTTTATCATAGGGATGCAGG - Intronic
1191928511 X:66342728-66342750 CAGTTTCTTCATAGTGTCGTTGG + Intergenic
1192030920 X:67511271-67511293 CAGTTTCTTCATTGTGTGGTTGG - Intergenic
1192142037 X:68654141-68654163 CAGTTTCCTCACTGGTAGTTTGG - Intronic
1192171793 X:68860352-68860374 CAGTTTACTCATTGAGAAGTGGG - Intergenic
1192233799 X:69283791-69283813 CAGTTTCCTCATCTGGAGAATGG + Intergenic
1192406625 X:70892313-70892335 CAGTTTCTTCATAGTGTTGTTGG - Intronic
1192729571 X:73789646-73789668 CAGTTTCTTCATAGTGTTGTTGG + Intergenic
1192758995 X:74076134-74076156 CAGTTTCTTCATAGTGTCGTTGG + Intergenic
1193075389 X:77349552-77349574 CAGTTTCCTCATAGCGTTGATGG - Intergenic
1194901187 X:99514075-99514097 CAGTTTCTTCATAGTGTTGTTGG + Intergenic
1194964218 X:100268875-100268897 CAGTTTCTTCATAGTGTGGGTGG - Intergenic
1196185221 X:112738293-112738315 CAGTTTCCTCATCTGGAAATAGG + Intergenic
1196414030 X:115452001-115452023 CAGTTTCCTCTTTGGGAAGTTGG + Intergenic
1198555458 X:137788586-137788608 CACTTTCCTCATCTGGAGGATGG - Intergenic
1199299222 X:146193579-146193601 CAGTTTCCTTATATGGAAATAGG + Intergenic
1199672935 X:150161809-150161831 CAGTTTCCTCATCTGTAGGATGG - Intergenic
1201389974 Y:13487502-13487524 CAGTTTCCTCATAGTGTCATTGG + Intergenic
1201800554 Y:17950380-17950402 CAGTTTCTTCATAGTGTTGTTGG + Intergenic
1201800999 Y:17955576-17955598 CAGTTTCTTCATAGTGTTGTTGG - Intergenic
1202047468 Y:20749284-20749306 CAGTTTCCTCACATGGTGGAAGG - Intergenic
1202360886 Y:24109182-24109204 CAGTTTCTTCATAGTGTTGTTGG - Intergenic
1202509892 Y:25560936-25560958 CAGTTTCTTCATAGTGTTGTTGG + Intergenic