ID: 1162854869

View in Genome Browser
Species Human (GRCh38)
Location 19:13460515-13460537
Sequence AAATTTCAGCCTAATGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162854869 Original CRISPR AAATTTCAGCCTAATGCATG TGG Intronic
901553560 1:10014122-10014144 AACTTTCAGCCTCATCCCTGAGG + Intronic
904222084 1:28979978-28980000 AATTTTCTGCCAAATGCATTGGG - Intronic
904985320 1:34542659-34542681 AAAATTCAGCTTTTTGCATGTGG - Intergenic
905755438 1:40505470-40505492 AACTTTCAGCCTAAAGACTGTGG - Intergenic
906683275 1:47745459-47745481 AAAATGCAGTCTGATGCATGTGG - Intergenic
906965405 1:50451661-50451683 AAATTTCACCCAAATGCCTAAGG - Intronic
907870461 1:58438218-58438240 AGAATTCTGCCTAATACATGGGG + Intronic
908535881 1:65076700-65076722 AAATTTCATCTTTTTGCATGTGG + Intergenic
908726004 1:67177816-67177838 CAGTTTCAGCCTTATGCATATGG + Intronic
908732855 1:67244510-67244532 CAGTTTCAGCCTTATGCATATGG + Intronic
908977360 1:69914249-69914271 ACATTCCAGCCAAATTCATGTGG + Intronic
910028291 1:82684792-82684814 AAATTTCAGTCTATTGAAAGAGG - Intergenic
915986866 1:160474861-160474883 AACTTCCACCCAAATGCATGTGG + Intergenic
916396699 1:164398068-164398090 AAATTTCATTCTTTTGCATGTGG - Intergenic
918535824 1:185573382-185573404 AGATTTCAGCTAAATGCATAAGG - Intergenic
919004309 1:191875111-191875133 ATTTTTCAGCCTAATACATAAGG + Intergenic
923095375 1:230771249-230771271 TAATTTATGCCAAATGCATGAGG + Intronic
923395652 1:233559830-233559852 CAATTTCATTCTTATGCATGTGG + Intergenic
923421580 1:233821365-233821387 AAATTTCATTCTTCTGCATGTGG + Intergenic
924498406 1:244612627-244612649 AAAATTGAGTATAATGCATGAGG + Intronic
1066156419 10:32683191-32683213 CAATTTCAGTCTACTGCATGTGG + Intronic
1070265055 10:74894040-74894062 AAGTTTCAGGCTAATTCATAAGG - Intronic
1070735159 10:78858789-78858811 AAAATTCATCCTTTTGCATGTGG + Intergenic
1072708564 10:97700195-97700217 ATATTTCAGACTATTGCATGGGG - Intergenic
1072860838 10:99003987-99004009 TAATTTCATTCTAGTGCATGTGG + Intronic
1073522145 10:104142701-104142723 ATATGCCAGCCTGATGCATGTGG + Intronic
1073840895 10:107497588-107497610 AAATTTCAACCGATTGAATGAGG - Intergenic
1078752625 11:14179448-14179470 AAATTTTATCCAAATGGATGGGG - Intronic
1080518971 11:33049911-33049933 ATATCTCAGGCTATTGCATGGGG + Intronic
1083045474 11:59731198-59731220 AAAATTCATCCCAATGCATTTGG - Intronic
1084206765 11:67599185-67599207 AAACTTCAGATAAATGCATGAGG - Intergenic
1085213786 11:74808986-74809008 AAATATTAGTCTAATTCATGAGG - Intronic
1087296200 11:96377131-96377153 AGATATCAGCCTAGTGTATGAGG + Intronic
1087491484 11:98833009-98833031 AAATTTCAGTCTAATGTTGGAGG + Intergenic
1087601406 11:100320754-100320776 TAATTTCAGTCTTCTGCATGTGG + Intronic
1087767348 11:102170268-102170290 ACATCTCAGCATAATGAATGTGG - Intronic
1088415822 11:109587942-109587964 CCATTTCATCCAAATGCATGAGG - Intergenic
1090112177 11:123924720-123924742 CAATTTCATCCTTTTGCATGTGG + Intergenic
1091595150 12:1873379-1873401 GAAGTTCAGCCTACTGCATTTGG + Intronic
1092249926 12:6888499-6888521 GAATCTCAGCCTAATGTATGTGG + Intronic
1092618119 12:10234196-10234218 CCAGTTCAGCCTGATGCATGAGG + Intergenic
1093742339 12:22703286-22703308 GAATTTCGGCCTCATTCATGTGG - Intergenic
1095667930 12:44824446-44824468 TAATTTCATTCTTATGCATGTGG + Intronic
1097425474 12:59438990-59439012 AACTTTCATCCTTCTGCATGTGG + Intergenic
1097677379 12:62617340-62617362 AATTTTCTGCCTATTCCATGGGG - Intergenic
1099517689 12:83618378-83618400 AAATTTCAACATAATGTTTGAGG + Intergenic
1099567518 12:84271284-84271306 AGATTTCAGCCAAATGTTTGAGG - Intergenic
1099813554 12:87617503-87617525 AAATTTATACCTAATGCTTGTGG - Intergenic
1100420977 12:94433133-94433155 AAATTCCAGTCTTCTGCATGTGG - Intronic
1101681230 12:106967826-106967848 CAAAATCAGCCTAATGCAAGAGG + Intronic
1102901717 12:116643904-116643926 ATTTTTCAGCCTACTGCAAGAGG - Intergenic
1103138509 12:118528236-118528258 TAATTTCAGCCTCATCTATGGGG - Intergenic
1106045565 13:26137192-26137214 AAATTTCACCCTCCTGCATCAGG - Intronic
1107686692 13:42908036-42908058 TAATTTCATCCTTCTGCATGTGG - Intronic
1108234426 13:48388512-48388534 AATTTTCATCATAATCCATGAGG + Intronic
1109666055 13:65539419-65539441 TAATCTCAGGCCAATGCATGGGG - Intergenic
1111164050 13:84434177-84434199 CAATTTCATCCTTTTGCATGTGG + Intergenic
1111563790 13:89988455-89988477 TACTTTCAGACTAATTCATGTGG + Intergenic
1112690331 13:101885975-101885997 AAATTTCAGGTTAATGCTTCAGG + Intronic
1112785494 13:102947045-102947067 AAATGACACCCAAATGCATGTGG - Intergenic
1113036763 13:106058465-106058487 AAAATTCAGCCATATGCAGGAGG - Intergenic
1113340096 13:109414395-109414417 CAGTTTCAGCCTTCTGCATGTGG + Intergenic
1114132603 14:19809794-19809816 ACATTTCAGTCTTTTGCATGTGG - Intronic
1116249878 14:42467558-42467580 TAATTTCATCCTTTTGCATGAGG + Intergenic
1117332348 14:54725556-54725578 CATTTTCAGCCTATTACATGTGG - Intronic
1120298288 14:82673371-82673393 AATTTTAACTCTAATGCATGGGG - Intergenic
1123409558 15:20047227-20047249 AAATCTCTGCATAATGCAGGAGG + Intergenic
1123518888 15:21053935-21053957 AAATCTCTGCATAATGCAGGAGG + Intergenic
1123575681 15:21665561-21665583 ACATTTCAGTCTTTTGCATGTGG - Intergenic
1123612301 15:22108034-22108056 ACATTTCAGTCTTTTGCATGTGG - Intergenic
1125265445 15:37874513-37874535 AAATTTCAGGCTATTGCAAATGG + Intergenic
1126926428 15:53592638-53592660 AAATTTCATGCTAAACCATGTGG - Intronic
1129573746 15:76718327-76718349 AAACATCAGCCTAAGGAATGGGG + Intronic
1131946688 15:97629731-97629753 ATATTTCAGACTATCGCATGGGG + Intergenic
1202984549 15_KI270727v1_random:399806-399828 ACATTTCAGTCTTTTGCATGTGG - Intergenic
1137768906 16:50999274-50999296 AATTTTCTGCCAAATGCATTGGG - Intergenic
1137770614 16:51013239-51013261 CAAATGCAGCCTAATGCACGAGG - Intergenic
1138040711 16:53662256-53662278 ATAATTCAGCATAATGCATATGG - Intronic
1141383717 16:83600016-83600038 AAACTTGAGCCTAATGGAAGTGG - Intronic
1141452051 16:84111009-84111031 ATTTTTCAGCCTACTGCAGGAGG - Intronic
1142048730 16:87943718-87943740 AAATTTCAGTCTTCTGCACGTGG - Intergenic
1142597737 17:1037709-1037731 AAATTGCAGCCTGAGGCAGGAGG + Intronic
1142766338 17:2066453-2066475 AAATTCCAGCCAAAAGCCTGAGG + Intronic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1144681376 17:17197875-17197897 AAATTTCAGAATAAGGCATGAGG - Intronic
1146132029 17:30286172-30286194 CAATTTCAGCCTCATGGATTAGG + Intronic
1147838753 17:43355293-43355315 ATATTTCAGACTATCGCATGGGG - Intergenic
1149021652 17:51973599-51973621 AAATTTCAGCTGAATGCTTGAGG - Intronic
1149794330 17:59505537-59505559 AAATTGCAGCCTAATGTAGGTGG - Intergenic
1150033426 17:61766484-61766506 AAATTTCAGCCTTCTACACGAGG + Intronic
1150616294 17:66775060-66775082 TAATTTCAGCCTAGAGCATGAGG - Intronic
1152489276 17:80618553-80618575 AAATTTCGGCCTCAGGGATGAGG - Intronic
1153591430 18:6677508-6677530 AAATTTGATCCTAATGTTTGAGG - Intergenic
1153753251 18:8255182-8255204 AAATATAAGCCTAATGAATAGGG + Intronic
1154075683 18:11198629-11198651 ATATTGCAACCTATTGCATGTGG - Intergenic
1154395628 18:13985721-13985743 CAATTTCAGTCTTCTGCATGTGG - Intergenic
1155879674 18:31129566-31129588 GAGTTGCAGCCTAATGCATCAGG + Exonic
1156528241 18:37789187-37789209 AAATTCTAGCTTCATGCATGAGG + Intergenic
1156965755 18:43089835-43089857 AATTTTTAGCCTTCTGCATGTGG - Intronic
1158274515 18:55752343-55752365 GAATTTTATCCTAATGCATAGGG - Intergenic
1161109868 19:2463079-2463101 AAATCTCAGCCTAACGGCTGTGG + Intergenic
1162854869 19:13460515-13460537 AAATTTCAGCCTAATGCATGTGG + Intronic
1164894856 19:31865422-31865444 AAATTTCATCCTTGTGCCTGTGG - Intergenic
925426799 2:3756113-3756135 AAGTTGCAGCATAAAGCATGAGG + Intronic
925549298 2:5052994-5053016 AACCTTCAGCCCAATGCATTTGG + Intergenic
926379194 2:12267390-12267412 AAATTTCAGCCAGATGAATTTGG - Intergenic
926997637 2:18753890-18753912 AAATTTCAGTCTACTGCAACTGG + Intergenic
927388412 2:22563628-22563650 AAATTACAGCTTAATGCCTGGGG - Intergenic
927565532 2:24109240-24109262 AAATTTCAATCTTCTGCATGTGG - Intronic
928183560 2:29088891-29088913 CAATTTCATCCTTCTGCATGTGG + Intergenic
928642187 2:33311360-33311382 GAATTTCACCTTATTGCATGAGG - Intronic
929387111 2:41422493-41422515 AAATTTCATTCTTCTGCATGTGG + Intergenic
929709915 2:44256264-44256286 AAATTTCAACCTGAAGCTTGAGG + Intergenic
931097762 2:58961344-58961366 TAATTTCATTCTACTGCATGTGG - Intergenic
931280381 2:60786061-60786083 AAATTTCAGCCCAATATATTAGG - Intronic
931280389 2:60786202-60786224 AAATTTCAGCCCAATATATTAGG - Intronic
932264035 2:70351552-70351574 AAATTTCATTCTTCTGCATGTGG + Intergenic
934302567 2:91788073-91788095 ATATTTCAGCCTCATGAATATGG - Intergenic
935209587 2:100927324-100927346 AAAATTCATCCTTTTGCATGTGG + Intronic
935846387 2:107170172-107170194 AAAATTCAGCCCATTACATGTGG - Intergenic
936253214 2:110884844-110884866 AATTTTCTGCCAAATGCATTGGG - Intronic
937165930 2:119817256-119817278 CAGTTTCAGCCTTATGCATATGG + Intronic
938054764 2:128206457-128206479 AAACTTCATCCTCTTGCATGTGG - Intergenic
939001544 2:136741241-136741263 AAGTTGCAGCCAAATGCAAGGGG + Intergenic
939291430 2:140201142-140201164 CAAATTCAGTCTAATGCTTGAGG + Intergenic
940803893 2:158163415-158163437 CAATTTCATCCTTTTGCATGTGG - Intergenic
941737021 2:168989322-168989344 AAATTTCATTCTTCTGCATGTGG + Intronic
944042572 2:195372980-195373002 AACTTTCCACCTAATCCATGAGG - Intergenic
944812160 2:203338208-203338230 AAATTTCATTCTTTTGCATGTGG - Intronic
946377094 2:219317933-219317955 TAATTTAAGCCTAAAGCAAGTGG - Intergenic
946423560 2:219579208-219579230 AAAGTTCAGCCTCCTTCATGTGG + Intergenic
946818787 2:223609147-223609169 ATATTTCAGCCCAATACAAGGGG - Intergenic
947476384 2:230451836-230451858 AAATTTCATTCTTCTGCATGTGG + Intronic
948163880 2:235845987-235846009 AAATTTAAGCCTCATCCAGGAGG - Intronic
948324218 2:237099459-237099481 AAATCTTAGACTAATGAATGTGG + Exonic
1171025595 20:21627541-21627563 AAATTTCTTCTTACTGCATGAGG - Intergenic
1171824738 20:29884613-29884635 ATATTTCAGACTATTGCATGGGG + Intergenic
1173189940 20:40868536-40868558 AAATTGCAGGCTAAGGCATTTGG + Intergenic
1173397271 20:42691117-42691139 CAATGTCAGCTTTATGCATGTGG + Intronic
1174170218 20:48613020-48613042 AGATATCAGCCTATTGCAGGGGG - Intergenic
1174953591 20:55070097-55070119 ACATTTCAGTTTAATGCCTGTGG + Intergenic
1176119469 20:63447558-63447580 AAAATTCCCCCAAATGCATGTGG + Intronic
1176766486 21:13024090-13024112 ATATTTCAGACTATTACATGGGG - Intergenic
1179229365 21:39487671-39487693 ACATTTCAGTCTAATGAATAAGG + Intronic
1181878870 22:25961443-25961465 AAATTTCAACATGATGCTTGAGG - Intronic
1182614666 22:31578928-31578950 AAATTGAAGCCTAAGGCATGGGG + Intronic
949190831 3:1246702-1246724 AAATTTTAGCCTTTTGCAGGGGG + Intronic
949409964 3:3753084-3753106 AAATTTCATCCTATTGCATTTGG + Intronic
949897772 3:8782206-8782228 AAATTTCATACTTTTGCATGTGG - Intronic
950166301 3:10802698-10802720 AATTTTCTGCCAAATGCATTGGG + Intergenic
953179083 3:40580014-40580036 GACTTTCACCCTAGTGCATGAGG + Intergenic
954071459 3:48146000-48146022 AAATTACAGTCTCATGCTTGAGG - Intergenic
955254671 3:57318355-57318377 AAATTTCATTCTTTTGCATGTGG + Intronic
956394362 3:68809752-68809774 TAATTTCATCCTTCTGCATGTGG + Intronic
958639676 3:96789585-96789607 AAATTTCATTCTTCTGCATGTGG + Intergenic
958913225 3:100018498-100018520 AAATTTCATTCTTCTGCATGTGG - Intronic
959263548 3:104111000-104111022 AAATTTCAGCTCCATTCATGGGG + Intergenic
961160975 3:124725317-124725339 AAACTTCAGCCTACTCTATGGGG + Intronic
963525943 3:146413519-146413541 GAATTTAAGCATAATGAATGAGG - Intronic
965172663 3:165287470-165287492 AAGTTTCAGCCAAATGAATTGGG - Intergenic
965743509 3:171901319-171901341 AAATTTCAGACTAAGAAATGTGG + Intronic
965813817 3:172616883-172616905 AATTTTCTGCCAAATGCATTGGG + Intergenic
965889440 3:173492852-173492874 AATTTTCAGCCTAAAGCATAGGG - Intronic
966143840 3:176787653-176787675 AAATTTGTGCCTTATGCAGGGGG - Intergenic
969760449 4:9177428-9177450 ATATTTCAGACTATCGCATGGGG + Intergenic
971088693 4:23312999-23313021 TAATTTCAGCATAATACATTAGG - Intergenic
971427273 4:26529017-26529039 AGATTTCAGCACTATGCATGGGG + Intergenic
971663470 4:29451233-29451255 CAATTTCATTCTTATGCATGTGG - Intergenic
972089268 4:35259294-35259316 AAATTTCATCCAAGTGTATGTGG + Intergenic
973345820 4:49054204-49054226 CAATTTCAGTCTTCTGCATGTGG + Intronic
973823256 4:54681491-54681513 AAAATACAACCTAATGCTTGAGG - Intronic
973826620 4:54713723-54713745 AAATTTCAGTATAGTGAATGTGG + Intronic
974419128 4:61648840-61648862 AAATTGAGGCCTAATGGATGTGG + Intronic
974507502 4:62795521-62795543 AGATTTCAGCCAAATGCCTGTGG - Intergenic
974679621 4:65144602-65144624 AAATTTTAGCAGAATCCATGTGG + Intergenic
977904941 4:102466563-102466585 GGATTTCAACCTAATGAATGGGG + Intergenic
978707029 4:111726002-111726024 AAATTTTATCCCAATGCATTAGG + Intergenic
979155698 4:117386795-117386817 GAGCTTCAGCCTAATGCCTGAGG + Intergenic
979405206 4:120301987-120302009 AAATTTCATCCTTTTGCATGTGG - Intergenic
979451561 4:120877318-120877340 AAATTTCAACCTAAGTGATGTGG - Intronic
983629179 4:169832474-169832496 CAATTTCAGTCTTCTGCATGTGG - Intergenic
984116541 4:175688395-175688417 CAATTTCATCATATTGCATGTGG + Intronic
985209491 4:187576999-187577021 AAATTGAAGCCAAATGTATGAGG + Intergenic
986236043 5:5911620-5911642 AAATTTCAGCCTAAATCGTTAGG - Intergenic
986263598 5:6172696-6172718 AAATTTCATCCTCCTGCATGTGG - Intergenic
987741132 5:21910178-21910200 AGATTTCTGAATAATGCATGTGG - Intronic
987936038 5:24466116-24466138 ATATTTCAGACTATTACATGGGG - Intergenic
988031114 5:25763982-25764004 TAAATTCATCCTAATGCATTTGG - Intergenic
989999030 5:50871260-50871282 AAAAGTCAGACTAATGCAGGAGG - Intergenic
991410291 5:66339004-66339026 AAATTTCAGCCTCTTTCTTGGGG + Intergenic
992418689 5:76579410-76579432 AAAGTTTAGCCTGATGCCTGTGG - Intronic
993197982 5:84774934-84774956 AAATTTGAGACTACTGCCTGGGG + Intergenic
993392011 5:87330116-87330138 TATTTTCAGCCTTATGCATAGGG + Intronic
995247378 5:109950088-109950110 AAATTTCAGCCCACTTCAGGAGG - Intergenic
1000043626 5:157503599-157503621 CAATTTCTGCCCATTGCATGAGG + Intronic
1002395297 5:178947820-178947842 AAATTCCCGCCTACTGCATTGGG - Intronic
1002933982 6:1656104-1656126 AAAATTCAGGCTAATACATTTGG - Intronic
1003006114 6:2383043-2383065 AAACATCTGCCTCATGCATGTGG - Intergenic
1003943239 6:11049207-11049229 AAATACCTACCTAATGCATGCGG - Intergenic
1005493493 6:26368683-26368705 AAGTTCCAGCCTAAGGCAGGTGG + Exonic
1007403390 6:41617508-41617530 AAATTTCAGCCCAATATATTAGG + Intergenic
1007403399 6:41617649-41617671 AAATTTCAGCCCAATATATTAGG + Intergenic
1007956563 6:45923173-45923195 AGATTTCAGCCTGATTCATTTGG - Intronic
1009193301 6:60655361-60655383 ATATTTCAGACTATTACATGGGG - Intergenic
1011399480 6:86944261-86944283 TAGTTTCAGCCTAATTCAAGGGG + Intronic
1013435852 6:110105895-110105917 AAATTTCAAACTAATGCCTGTGG - Intronic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1017275468 6:152562353-152562375 AATATACATCCTAATGCATGAGG - Intronic
1022429345 7:30300963-30300985 AAATTTCAGCCTTGTGCAAGAGG + Intronic
1022889067 7:34677244-34677266 AAGTTTCTGCCTAATGGAAGAGG - Intronic
1022950458 7:35333187-35333209 AAATTTGAGAGTAAAGCATGAGG + Intergenic
1025037987 7:55611572-55611594 CAATTTCATCCTTTTGCATGTGG + Intergenic
1025107940 7:56188246-56188268 AAATTCCATCCTAAAACATGTGG - Intergenic
1027442900 7:78239204-78239226 TAATTTCATCCTTCTGCATGGGG - Intronic
1029054029 7:97721268-97721290 AACATTCAGTCTAATGCATATGG + Intergenic
1030900979 7:115123004-115123026 ACATTTTAGCATACTGCATGTGG + Intergenic
1031230628 7:119100840-119100862 ATATTTCAGCCTATCACATGGGG + Intergenic
1033669264 7:143475253-143475275 AAATTTCATTCTTCTGCATGTGG - Intergenic
1034860997 7:154594752-154594774 AAGTTTCGGACTAATGCATTTGG + Intronic
1036846062 8:12171504-12171526 ATATTTCAGACTATCGCATGGGG - Intergenic
1036867427 8:12413823-12413845 ATATTTCAGACTATCGCATGGGG - Intergenic
1041019209 8:53621255-53621277 AAATTTAAGCCAACTGAATGTGG + Intergenic
1041104403 8:54427215-54427237 AAATTTCAGCCTCTTGCCTGAGG - Intergenic
1043106933 8:76125640-76125662 AAAAGTCAAGCTAATGCATGTGG + Intergenic
1043362234 8:79487675-79487697 AAATATATGCCTTATGCATGAGG + Intergenic
1044459757 8:92430206-92430228 AAATTTCAACATAAGGCTTGAGG - Intergenic
1046865279 8:119142410-119142432 CAGTTTCAGCCTTTTGCATGTGG - Intergenic
1047658847 8:127010390-127010412 AAATTTCAGCCTGATGTGTCTGG + Intergenic
1048297071 8:133222271-133222293 TAATGTCAATCTAATGCATGGGG + Intronic
1050606716 9:7309339-7309361 AAATTCCTGCCTAATACATTTGG + Intergenic
1051030284 9:12666617-12666639 AATTTTCAGCCAAATGCCTTGGG - Intergenic
1052265800 9:26571773-26571795 AATTTTCTGCCAAATGCATTGGG + Intergenic
1054734745 9:68739546-68739568 AAATTTCAGCCTCCTTCTTGGGG + Intronic
1055041689 9:71881283-71881305 AAATTTCATTCTTTTGCATGTGG - Intronic
1055830258 9:80370020-80370042 AAAGTTTAGACTAATGCAGGTGG + Intergenic
1060791673 9:126489446-126489468 AAATTTCACCCAAGTGCATCAGG - Intronic
1187622039 X:21067473-21067495 AAATTTTATTCTTATGCATGAGG + Intergenic
1191033341 X:55998368-55998390 ATATTTCAGACTATTACATGGGG + Intergenic
1192176766 X:68891142-68891164 AAATCCCAGGCTCATGCATGTGG - Intergenic
1192889085 X:75368952-75368974 AAATTGTAGCCTTTTGCATGCGG - Exonic
1193088187 X:77466317-77466339 AAATTTCATTCTTCTGCATGTGG + Intergenic
1193539333 X:82752529-82752551 AAATTACAACATAAGGCATGGGG - Intergenic
1193675351 X:84445582-84445604 ATATATGAGACTAATGCATGGGG + Intronic
1194616788 X:96114143-96114165 CAATTTCATTCTTATGCATGTGG - Intergenic
1194922835 X:99788548-99788570 AAATTTCAGTCTTCTGCATATGG + Intergenic
1196665803 X:118314861-118314883 AATTTTCTGCCAAATGCATTGGG + Intergenic
1197028591 X:121785837-121785859 AATTTTCTGCTTAATGCATAAGG + Intergenic
1198696332 X:139342518-139342540 AAATTTCAGACTATCACATGGGG + Intergenic
1199103590 X:143836763-143836785 AAATTTCATTCTGCTGCATGTGG + Intergenic
1201964958 Y:19722322-19722344 AAGTTTCATCCTTTTGCATGTGG - Intronic