ID: 1162855049

View in Genome Browser
Species Human (GRCh38)
Location 19:13461667-13461689
Sequence GAACTCAGGCTTTCTAAATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162855049_1162855052 -7 Left 1162855049 19:13461667-13461689 CCCGATTTAGAAAGCCTGAGTTC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 1162855052 19:13461683-13461705 TGAGTTCTAACTCACAGCTGCGG 0: 1
1: 0
2: 2
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162855049 Original CRISPR GAACTCAGGCTTTCTAAATC GGG (reversed) Intronic
900108410 1:995908-995930 GATCACAGGCTTTTGAAATCTGG - Intergenic
905303747 1:37003777-37003799 GGACTCAGACTTTGTAAATATGG - Intronic
906416199 1:45622750-45622772 GAACTCTGGCTGCCGAAATCCGG - Exonic
907420190 1:54342009-54342031 GAAGGCAGGCTTTCAAAATGCGG + Intronic
908226947 1:62065827-62065849 GAACTCAGACTTTCTCACACCGG + Intronic
909158604 1:72115013-72115035 AAAATCTGGCTTTCTAAACCTGG + Intronic
910013528 1:82494498-82494520 CTACTCAGGATTTATAAATCAGG - Intergenic
910526854 1:88188943-88188965 CTACTCAGGCTTGCAAAATCAGG + Intergenic
913715244 1:121527340-121527362 TAAGTCAGACTTTCTAAGTCAGG - Intergenic
916726666 1:167529657-167529679 GAACTCAGCCATGCTATATCAGG - Intronic
916839446 1:168584735-168584757 GTACTCAGGCCTTCTCAGTCCGG - Intergenic
916967725 1:169969218-169969240 GAACTCAAGCTTTCAAGAGCAGG - Intronic
917592579 1:176491967-176491989 GAACCCAGGCTCTTTAATTCTGG + Intronic
920415054 1:205793550-205793572 GAACACAACCTTTCTAAAGCTGG + Intronic
921581786 1:216903951-216903973 GAACCCAGGCTCTTTGAATCAGG - Intronic
924330395 1:242935581-242935603 GAACCCAGGCTGTCTGATTCTGG + Intergenic
924760222 1:246977465-246977487 GAAGTCAGGCTTTCGAAACCTGG - Intronic
1063803865 10:9614851-9614873 GAACTCATACTTTATAAATGTGG - Intergenic
1065473713 10:26111230-26111252 AAACTCATGCTTTCTGAGTCAGG - Intronic
1072224843 10:93359608-93359630 GCCCCCAGGATTTCTAAATCAGG + Intronic
1074128820 10:110554645-110554667 GAGCTCAGGAGTTCGAAATCAGG + Intergenic
1074159657 10:110827161-110827183 GAACTCAGGATTTCTCAGCCTGG + Intronic
1075026219 10:118985402-118985424 GAACTCAGGAGTTCAAAACCAGG + Intergenic
1076057487 10:127387376-127387398 TAAGCCAGGCTTTCTCAATCTGG + Intronic
1077927543 11:6696937-6696959 TAACTCAGGTGTTCTTAATCTGG - Intergenic
1078903367 11:15661928-15661950 TAACTCAGGGGTTCTTAATCTGG + Intergenic
1090061664 11:123469038-123469060 GAACTCAGGCAGTCCAAAGCTGG + Intergenic
1095255582 12:40032012-40032034 TAAGTCAGGGTTTCTAAACCTGG + Intronic
1095669453 12:44841529-44841551 GAACTCTGGCTTTCTACCTAGGG + Intronic
1097409858 12:59238501-59238523 CACCTCAGACTTTCTAAATTAGG - Intergenic
1100213545 12:92423705-92423727 TAACTCAGGCAGTCTAACTCAGG + Intronic
1100292909 12:93234694-93234716 GAAGTCAAGCTCTCTACATCTGG - Intergenic
1100567563 12:95812533-95812555 GTACTCAGGCATTTTAACTCTGG - Intronic
1102500561 12:113349252-113349274 CAACTAAGGCTTTCTAAAGTGGG + Intronic
1102745308 12:115244247-115244269 TTACTCAAGCTTTCTAAATCTGG + Intergenic
1103701674 12:122851276-122851298 GAGCTGAAGCTTTCTGAATCAGG + Exonic
1106368151 13:29104136-29104158 GAGCAGAGGCTTTCTAAGTCAGG + Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1110352842 13:74529807-74529829 GAAGTCATGTTTTCTAGATCTGG + Intergenic
1115223777 14:31083367-31083389 GAACTAAGTCTTTCTAGACCTGG + Intronic
1115333117 14:32219491-32219513 GAACTCATGCTTGCTTATTCTGG - Intergenic
1117622094 14:57597912-57597934 GAAACCAGGCTGTCTAAACCTGG + Intronic
1120079888 14:80203829-80203851 GACCTCAGGTTTTCTAGATCTGG - Intronic
1125170917 15:36765525-36765547 AAACACAGGCCTTCTAACTCTGG + Intronic
1126917241 15:53479391-53479413 GAACCCAGGCTATCTAGCTCTGG - Intergenic
1126952465 15:53896736-53896758 AAATTCTGGCTTTCTAAATGTGG + Intergenic
1127299782 15:57641704-57641726 AAACACAAACTTTCTAAATCAGG - Intronic
1133018726 16:2956553-2956575 GAACTCTGAGTTTCCAAATCAGG + Intergenic
1133664283 16:7950592-7950614 GAACTCAGCCTCTGTAAATGTGG - Intergenic
1133683938 16:8147876-8147898 GAACTCAGGCTTTCATCCTCAGG + Intergenic
1134058600 16:11185538-11185560 GAATTCAGGCTTTAAGAATCTGG - Intergenic
1134193241 16:12138690-12138712 AAACACAGGCTTCCTAAATCAGG - Intronic
1134823570 16:17266538-17266560 GAACCCAGGCTGTCTAGGTCTGG + Intronic
1135176749 16:20236603-20236625 GCATTCAGCCTTTGTAAATCTGG - Intergenic
1137225513 16:46503208-46503230 GAACTCACATTTTCTAATTCAGG + Intergenic
1138051414 16:53782667-53782689 GAGCTCAGGCTGTACAAATCAGG + Intronic
1141136124 16:81466863-81466885 GAACTTTGGCTTTCTAAACTTGG - Intronic
1144416403 17:15051615-15051637 GAGCTCCACCTTTCTAAATCTGG + Intergenic
1144466782 17:15503435-15503457 GCACTGAGGCGTTCTAAAGCAGG - Intronic
1144610541 17:16709468-16709490 GAACTCAGATTTTCTAATTTAGG - Exonic
1144902204 17:18605925-18605947 GAACTCAGATTTTCTAATTTAGG + Intergenic
1144928860 17:18840027-18840049 GAACTCAGATTTTCTAATTTAGG - Intergenic
1145130297 17:20340152-20340174 GAACTCAGATTTTCTAATTTAGG - Intergenic
1148295675 17:46500598-46500620 AAACCCAGGCCTACTAAATCAGG - Intergenic
1150406922 17:64909353-64909375 AAACCCAGGCCTACTAAATCAGG + Intronic
1150948935 17:69780016-69780038 GTTCTCAGGCCTTCGAAATCAGG - Intergenic
1158655120 18:59323930-59323952 GAACTAAGGCTTTGTAACTGAGG - Intergenic
1158891364 18:61875152-61875174 GAAGGCAGGCATTCTAAATGAGG + Intronic
1159389709 18:67774540-67774562 GAACACATGCTTTTTAAATAAGG - Intergenic
1162855049 19:13461667-13461689 GAACTCAGGCTTTCTAAATCGGG - Intronic
1164372097 19:27651917-27651939 GAACACAGGCTTTCTAATGATGG - Intergenic
1164374520 19:27673590-27673612 AAACTCAGGCATTCTAATTGGGG - Intergenic
1165237974 19:34438851-34438873 GAACTCAGGATGTTTAAATATGG + Intronic
925279503 2:2672873-2672895 TAACTAAGGCTTTCTAAAGAGGG - Intergenic
925776652 2:7342653-7342675 GCACAGAGGGTTTCTAAATCTGG - Intergenic
926976435 2:18520974-18520996 AAACTCAGGATTTCCAAATGAGG - Intergenic
931701001 2:64908986-64909008 GATCTCATGCTTTGTAAATGTGG + Intergenic
932184627 2:69683192-69683214 AAACTCAGGCCTGCTAAATGCGG + Intronic
939008176 2:136813991-136814013 GACCTCAGGTTTTCTGACTCAGG + Intronic
939014543 2:136886665-136886687 TAACTCAGGGTTTCTCAACCTGG - Intronic
940535404 2:154935171-154935193 GAACTCAGGCTGTGTGAATTTGG - Intergenic
945629901 2:212261015-212261037 GAACCCAGGTTTTCTCATTCTGG - Intronic
947790197 2:232861912-232861934 GATCTCAGGCTTTCCCAATGGGG + Intronic
949018365 2:241726264-241726286 AAACCCAGGCTTCTTAAATCAGG - Exonic
1169738214 20:8860652-8860674 GGACTCAGGCTGGCTGAATCAGG + Intronic
1170466174 20:16624278-16624300 GAACTCAGGCATTCAGATTCTGG - Intergenic
1170737735 20:19026045-19026067 GCCCCCAGGCTTCCTAAATCAGG + Intergenic
1170947739 20:20906771-20906793 GAATGCAGGATTTCAAAATCTGG - Intergenic
1172652540 20:36514202-36514224 GACCTCTGCCTTTCTAGATCTGG - Intronic
1183194203 22:36342263-36342285 GAACTCAGGATATCTGACTCTGG - Intronic
1183668519 22:39258414-39258436 GAAGTCAGGCTTTCTGGCTCCGG - Intergenic
1184952047 22:47850320-47850342 TAACTCAGGCGCTCTAAATGTGG - Intergenic
949180482 3:1124268-1124290 TAATTCAGGGTTTCTCAATCTGG - Intronic
950422150 3:12905560-12905582 GAGCTCAGGCTGTCTGATTCTGG + Intronic
950720305 3:14877674-14877696 GCACTCAGGCTTCCTCACTCCGG - Intronic
951889740 3:27557267-27557289 AAACACAGGTTTTCTGAATCTGG + Intergenic
952467934 3:33610909-33610931 GAACTCTGCCTTTTTAAATTAGG - Intronic
954850937 3:53599878-53599900 GAAGGCAGGCTTTCAAAATTAGG - Intronic
956700675 3:71956165-71956187 TAACTCAGGGTTTCTCAACCTGG - Intergenic
957301504 3:78397567-78397589 AAACTCAGTATTTCCAAATCTGG - Intergenic
960307659 3:116081581-116081603 GAAATGAGGCTTTTTAAATGTGG + Intronic
962271034 3:133978337-133978359 GTACTCAGGCTTTCTGATGCCGG + Intronic
964404261 3:156331982-156332004 GAACTCAGGATATCTAAGGCTGG + Intronic
967456412 3:189691404-189691426 CAACTCAGGATTTCTCAACCTGG + Intronic
967888192 3:194347177-194347199 GAAGTCTGGCTTTTTAAATGGGG + Intronic
970272482 4:14362104-14362126 CAACTCAGGCAGTCTAAATGTGG - Intergenic
970349335 4:15185596-15185618 GAACTCAGGCTCTATTTATCTGG - Intergenic
970567020 4:17341375-17341397 GAACCCAGGCTGTCTAACTCTGG - Intergenic
971711259 4:30116016-30116038 GGAGTCAGGCTTACTAAATCTGG + Intergenic
972113315 4:35593892-35593914 GAACACAGGCATTCTAAATGTGG - Intergenic
974190953 4:58502976-58502998 TACCTCTGGCTTTCTAAGTCAGG - Intergenic
974417243 4:61624695-61624717 TAACTCAGCCTTTCTCAACCTGG - Intronic
975001655 4:69231209-69231231 GAAATCAGGCATTCAAAAACAGG + Intergenic
975003793 4:69260875-69260897 GAATTCAGGCATTCAAAAACAGG - Intergenic
975012153 4:69369468-69369490 GAATTCAGGCATTCAAAAACAGG - Intronic
975634475 4:76432973-76432995 GGACTCAGGCTTTCTAATAGAGG - Intergenic
980545347 4:134254742-134254764 GAATTCAGCCATTCCAAATCTGG - Intergenic
981008528 4:139900450-139900472 GAACTTAGAGTTTCTAAATGTGG - Intronic
981878074 4:149573298-149573320 TAACTAAGTGTTTCTAAATCAGG + Intergenic
985393647 4:189517542-189517564 GAACCCAAGCCTTCTAACTCAGG - Intergenic
986826178 5:11525476-11525498 GATCTCAGCCTTTGTAAATAAGG + Intronic
990849343 5:60184022-60184044 CAACTCAGGTTCTCTTAATCTGG + Intronic
992695354 5:79280908-79280930 CTACTCAGACTTTTTAAATCTGG + Intronic
996409501 5:123142934-123142956 AAACTCAGGATTTCTAGCTCAGG + Intronic
996944126 5:129046350-129046372 GGTCTCAGGCTTTCTGAGTCAGG - Intergenic
997713346 5:136024373-136024395 AAACACTGGCTTTCTTAATCAGG - Intergenic
998516153 5:142756045-142756067 TGACTCAGTATTTCTAAATCTGG + Intergenic
998778682 5:145631944-145631966 GAAATCAGTCTTTGAAAATCTGG + Intronic
1000994012 5:167940772-167940794 GAACAAAGGCATTTTAAATCTGG - Intronic
1003655192 6:8000576-8000598 CAACTCAGACTTTTAAAATCTGG + Intronic
1005622448 6:27632525-27632547 GTTCTCAGGCCTTCAAAATCTGG - Intergenic
1009719749 6:67452476-67452498 TATCTCAATCTTTCTAAATCAGG + Intergenic
1009744089 6:67790453-67790475 GAATTCATGCTTTCAAATTCTGG + Intergenic
1011350856 6:86422154-86422176 GAACTAAGACTTCCTAAATTTGG - Intergenic
1012551644 6:100469137-100469159 CAACTGAGGCGTTCTAACTCTGG + Intergenic
1013768095 6:113596672-113596694 GAATTCACACTTTATAAATCTGG + Intergenic
1014780034 6:125554510-125554532 CAACTCAGCCTTTCTAAATAAGG - Intergenic
1015789859 6:136955579-136955601 GAATTCAAGGTTTATAAATCAGG + Intergenic
1015950691 6:138549572-138549594 GAACTCGGGTTTCCTAAATAGGG + Intronic
1016304333 6:142667711-142667733 GAAGTCAAGTTTTCTTAATCAGG + Intergenic
1017031988 6:150232072-150232094 GAACTCATGATTTCTACACCTGG + Intronic
1019349184 7:545582-545604 GTAATCAGGCTTTCTAATTTTGG - Intergenic
1021038360 7:15829432-15829454 GAACCCAGAATTTCTAAATTAGG + Intergenic
1021537861 7:21725268-21725290 GATCTCTGGAATTCTAAATCTGG - Intronic
1021621005 7:22550873-22550895 GGAATCAGTCTTTTTAAATCTGG + Intronic
1023000021 7:35799208-35799230 GAACTCAGGCAGTCTGACTCCGG + Intergenic
1024440167 7:49407920-49407942 GAACTCAGGAGTTCTAGACCAGG - Intergenic
1027565580 7:79788759-79788781 GGACTCAAGCTTTCTAATTGAGG + Intergenic
1030039439 7:105436563-105436585 GAACTAAGGTTTTGTGAATCAGG - Intergenic
1030279388 7:107755803-107755825 GAACCCAGGAATTCTAATTCTGG - Intronic
1030614829 7:111728570-111728592 AACCTCAGGCTTTGAAAATCAGG - Exonic
1032636161 7:133711549-133711571 GAACTCAGACTCTGTCAATCTGG + Intronic
1032992704 7:137411599-137411621 GAAGTCAGACTTTCTAAGTTTGG - Intronic
1033021747 7:137732335-137732357 GTACTCAGGCATTGCAAATCAGG - Intronic
1045861418 8:106818572-106818594 GAAGTCAGGCTTGTTAAACCTGG + Intergenic
1046595913 8:116260906-116260928 GATCCCAGGACTTCTAAATCAGG - Intergenic
1051088578 9:13380304-13380326 GAACTCTTTTTTTCTAAATCTGG - Intergenic
1051178584 9:14386259-14386281 GAACTTAGGCTTTCAAGCTCTGG - Intronic
1051397725 9:16643902-16643924 GAACTCAAGATTTTTAAAACTGG - Intronic
1051486389 9:17613096-17613118 GACCTTAGGCTGTCTAAATACGG + Intronic
1053425518 9:38007526-38007548 AAACTCAGACTTTCCAGATCTGG + Intronic
1054937914 9:70709144-70709166 GAACTCCATCTTGCTAAATCTGG + Intronic
1054939605 9:70727137-70727159 GAACTCCATCTTGCTAAATCTGG + Intronic
1055164480 9:73174937-73174959 GAACACAGGCTTTCTGACTATGG + Intergenic
1057587201 9:96339622-96339644 GCACTCAGGGTTTTTTAATCAGG + Intronic
1058060760 9:100493252-100493274 GAACTCAGGGTTTCTCAGTCTGG - Intronic
1058695367 9:107554464-107554486 GAACTCTTGATTTCTAAAGCCGG - Intergenic
1061997292 9:134192942-134192964 AACCTCAGGCTGTCCAAATCAGG - Intergenic
1062308394 9:135922167-135922189 GGACCCAGGCCTTCCAAATCGGG + Intergenic
1187415334 X:19088084-19088106 GAACTAAGGCATTCCAAAACAGG + Intronic
1191233706 X:58117561-58117583 GAACTCAGGCATTCTAAGGATGG + Intergenic
1191242299 X:58199012-58199034 GACCTCAGGCATTCTAAAAATGG + Intergenic
1191246229 X:58230413-58230435 GAACTCAGGCATTCTAATGAGGG + Intergenic
1191248525 X:58247080-58247102 GAACCCAGGCTTTCTAATGATGG + Intergenic
1191248770 X:58248750-58248772 GAACCCAGGCATTCTAAAGATGG + Intergenic
1194032375 X:88832777-88832799 AAACTCAGGGATTCTATATCTGG - Intergenic
1194832777 X:98645515-98645537 GAACTCAGGTCTTCTGACTCTGG + Intergenic
1197094290 X:122574798-122574820 GCACTCAGGCTTTCTTACACAGG + Intergenic
1197464529 X:126786205-126786227 GAGGTTAGGCTTTCTAAGTCTGG - Intergenic
1198389612 X:136161082-136161104 GAACCCAGCCTGTCTATATCTGG - Intronic
1198399546 X:136255757-136255779 GAACACATGCTTTCCAAATACGG - Intronic
1199163000 X:144636590-144636612 GAATTCACACTTTCTAAATCTGG - Intergenic