ID: 1162860991

View in Genome Browser
Species Human (GRCh38)
Location 19:13505836-13505858
Sequence GAGAGAGACCCGGGGGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 196}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162860991_1162861003 0 Left 1162860991 19:13505836-13505858 CCATCAACCCCCGGGTCTCTCTC 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1162861003 19:13505859-13505881 CCAGCCTGGAAGAGGGGAGGCGG 0: 1
1: 2
2: 8
3: 88
4: 699
1162860991_1162860998 -7 Left 1162860991 19:13505836-13505858 CCATCAACCCCCGGGTCTCTCTC 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1162860998 19:13505852-13505874 CTCTCTCCCAGCCTGGAAGAGGG 0: 1
1: 0
2: 5
3: 60
4: 728
1162860991_1162861012 16 Left 1162860991 19:13505836-13505858 CCATCAACCCCCGGGTCTCTCTC 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1162861012 19:13505875-13505897 GAGGCGGAGGGAGGAGGGGGAGG 0: 1
1: 12
2: 192
3: 1099
4: 6847
1162860991_1162861000 -3 Left 1162860991 19:13505836-13505858 CCATCAACCCCCGGGTCTCTCTC 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1162861000 19:13505856-13505878 CTCCCAGCCTGGAAGAGGGGAGG 0: 1
1: 0
2: 5
3: 52
4: 470
1162860991_1162861006 4 Left 1162860991 19:13505836-13505858 CCATCAACCCCCGGGTCTCTCTC 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1162861006 19:13505863-13505885 CCTGGAAGAGGGGAGGCGGAGGG 0: 1
1: 1
2: 5
3: 47
4: 604
1162860991_1162861009 11 Left 1162860991 19:13505836-13505858 CCATCAACCCCCGGGTCTCTCTC 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1162861009 19:13505870-13505892 GAGGGGAGGCGGAGGGAGGAGGG 0: 1
1: 6
2: 85
3: 841
4: 5490
1162860991_1162861010 12 Left 1162860991 19:13505836-13505858 CCATCAACCCCCGGGTCTCTCTC 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1162861010 19:13505871-13505893 AGGGGAGGCGGAGGGAGGAGGGG 0: 1
1: 6
2: 87
3: 1095
4: 7079
1162860991_1162861004 3 Left 1162860991 19:13505836-13505858 CCATCAACCCCCGGGTCTCTCTC 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1162861004 19:13505862-13505884 GCCTGGAAGAGGGGAGGCGGAGG 0: 1
1: 0
2: 9
3: 104
4: 1049
1162860991_1162860997 -8 Left 1162860991 19:13505836-13505858 CCATCAACCCCCGGGTCTCTCTC 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1162860997 19:13505851-13505873 TCTCTCTCCCAGCCTGGAAGAGG 0: 1
1: 0
2: 8
3: 42
4: 423
1162860991_1162861008 10 Left 1162860991 19:13505836-13505858 CCATCAACCCCCGGGTCTCTCTC 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1162861008 19:13505869-13505891 AGAGGGGAGGCGGAGGGAGGAGG 0: 1
1: 5
2: 42
3: 667
4: 5509
1162860991_1162860999 -6 Left 1162860991 19:13505836-13505858 CCATCAACCCCCGGGTCTCTCTC 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1162860999 19:13505853-13505875 TCTCTCCCAGCCTGGAAGAGGGG 0: 1
1: 0
2: 3
3: 37
4: 422
1162860991_1162861011 13 Left 1162860991 19:13505836-13505858 CCATCAACCCCCGGGTCTCTCTC 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1162861011 19:13505872-13505894 GGGGAGGCGGAGGGAGGAGGGGG 0: 3
1: 14
2: 263
3: 1428
4: 7599
1162860991_1162861007 7 Left 1162860991 19:13505836-13505858 CCATCAACCCCCGGGTCTCTCTC 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1162861007 19:13505866-13505888 GGAAGAGGGGAGGCGGAGGGAGG 0: 1
1: 1
2: 36
3: 425
4: 3104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162860991 Original CRISPR GAGAGAGACCCGGGGGTTGA TGG (reversed) Intronic
901773040 1:11540474-11540496 GAGAGAGAAGCGGGGGCTCAGGG - Intergenic
901883055 1:12205162-12205184 GAGGGAGGCCAGGGGGTGGAGGG + Intronic
902480218 1:16707746-16707768 GAGAGAGGGCCGGGGGATGGGGG + Intergenic
902525395 1:17054044-17054066 GAGAGCGACCTCGGGGTTAAGGG - Exonic
903949816 1:26989932-26989954 GAGAGAGAGACGGGGGTGGGGGG - Intergenic
904433706 1:30480557-30480579 GAGAGAGGTCCTGGGGTGGAGGG + Intergenic
904847305 1:33430366-33430388 CAGAGGGAACCGGGGGTTGCTGG - Intronic
905224167 1:36468231-36468253 GAGAGAGGTGCGGGGGCTGAAGG + Intronic
905385815 1:37603343-37603365 GAGAGAGAGCCGGTGCTAGAGGG + Intergenic
905545889 1:38800450-38800472 GAGAGAGACCAGGGGATAGCTGG + Intergenic
905778935 1:40691319-40691341 GAGAAAGAACTGGGGGATGAAGG - Intergenic
906209169 1:44002722-44002744 GAGAGGGACCAGGGGGCTGGTGG - Intronic
909523291 1:76593983-76594005 GAGAAAGACCCCAGGGTGGAAGG + Intronic
910525008 1:88167415-88167437 GAGAGAGACCCACGGTTTGCAGG + Intergenic
911102073 1:94103157-94103179 GAGAAAGAACAGGGTGTTGAAGG + Intronic
912008572 1:104932829-104932851 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
912421116 1:109543079-109543101 TAGAGGGACCTGGGGTTTGAGGG - Exonic
914385552 1:147166385-147166407 GAGAGAGAGCAGGGGGTTGGGGG - Intronic
914689066 1:150009914-150009936 GGGAGAGAGACGGAGGTTGACGG - Intronic
915318999 1:155045879-155045901 GAGAAAGACCTGTGGGTGGATGG - Exonic
916724070 1:167507300-167507322 GAGAAAGACCATGGGTTTGAAGG + Intronic
918417100 1:184321277-184321299 GAGAGAGAGATGGGGGATGAAGG + Intergenic
919013962 1:192004608-192004630 GAGAGAGACCTGGAAGCTGAAGG + Intergenic
921023566 1:211258697-211258719 GAGAGAGAGTCTGGGGATGACGG - Intronic
921222312 1:212981753-212981775 AAGAGAGACTGGGTGGTTGAGGG + Intronic
922176324 1:223200715-223200737 GTGAGAGATCCGGGGATTCAGGG - Intergenic
922739839 1:228008676-228008698 GAGAGAGCCCCGAGGGCTGCCGG + Intronic
1064379817 10:14831304-14831326 GTGGGAGTCCAGGGGGTTGAAGG - Intronic
1066101321 10:32121249-32121271 GTGAGAGGTCCTGGGGTTGAGGG + Intergenic
1067337544 10:45377492-45377514 GACAGAGAGCCGGAGATTGAGGG - Intronic
1067451636 10:46385327-46385349 GAGGGAGACCAGGGAGGTGAGGG - Intronic
1067585603 10:47474429-47474451 GAGGGAGACCAGGGAGGTGAGGG + Intronic
1067710859 10:48650036-48650058 GAGAGAGACCAGGAGGTGGCAGG + Intronic
1069940068 10:71949189-71949211 GAGAGAGACCCTGGGGTTGTTGG + Intergenic
1069942006 10:71962933-71962955 GAGAGAGACCCTGGGGTTGTCGG + Intergenic
1077371918 11:2186285-2186307 GTGAGAGGCCCTGGGGCTGAGGG - Intergenic
1080285518 11:30606770-30606792 GAGAGAGACCGGGGAGATAAAGG - Intergenic
1081789806 11:45774702-45774724 GAGAGGGACCGGGGTGTTGGCGG - Intergenic
1081935706 11:46902726-46902748 GAGAGGGACCTGGGGGTGGGGGG - Intronic
1083300573 11:61737823-61737845 GAGAGAGATGCGGGGGCTGGGGG - Intronic
1083854206 11:65384367-65384389 GAGAGAGTCCGGGAGGCTGATGG - Intergenic
1085385339 11:76154481-76154503 GAGGGAAACCCAGGGGTTAAAGG - Intergenic
1087007441 11:93483510-93483532 GAGAGAGGCCTGGGGGTGGAGGG + Intronic
1088714266 11:112535048-112535070 GAGGGAGACATGGGGGTGGAGGG + Intergenic
1090451562 11:126810902-126810924 GGGAGAGAGCCCGGGCTTGAGGG - Intronic
1090833333 11:130435626-130435648 AAGAGAGACCCTGAGGATGAGGG - Intergenic
1092097220 12:5852910-5852932 GAGAGAGAAGAGGGGGTGGAGGG + Intronic
1096475235 12:51905612-51905634 GACAGAGATCCAGGGGTTGGGGG + Intergenic
1097713135 12:62936385-62936407 GAGAGTGGCCCAGGTGTTGAAGG + Intergenic
1102950197 12:117026217-117026239 GAGAAAGACCCGGGGAGGGAGGG - Intronic
1102950224 12:117026314-117026336 GAGAAAGACCCGGGGAGGGAGGG - Intronic
1104526597 12:129529773-129529795 GAGATGGACACGGGGGTGGACGG - Intronic
1104950129 12:132436250-132436272 GAGAGAGACCCTGAGCTCGAAGG + Intergenic
1104950209 12:132436620-132436642 GAGAGAGACCCTGAGCCTGAAGG + Intergenic
1104950232 12:132436734-132436756 GAGAGAGACCCTGAGCCTGAAGG + Intergenic
1105448174 13:20475226-20475248 GGGAGAGACACGGGGTGTGATGG - Intronic
1106924580 13:34600625-34600647 GAGTGAGACAGGGAGGTTGAAGG + Intergenic
1111347263 13:86974760-86974782 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
1111950864 13:94708092-94708114 GAGAAAGGCCCGGGGGTGGGTGG - Intergenic
1112418475 13:99226163-99226185 GAGAGAGACCTGGCAGGTGAAGG + Intronic
1112734470 13:102400936-102400958 GGGAGGGACGCGGGGGCTGACGG + Intronic
1113182988 13:107653008-107653030 CAAAGATACACGGGGGTTGAAGG + Intronic
1113695255 13:112341671-112341693 GAGAGAGAGGCGGGGGGAGAGGG - Intergenic
1114553975 14:23551071-23551093 AAGAGAGATGCGGGGGTGGAGGG - Intronic
1118973151 14:70654242-70654264 CAGAGAGAGCTGGGGGATGAGGG - Intronic
1119559538 14:75579091-75579113 GACAGAGACGCTGGGGTTGATGG - Exonic
1120037560 14:79715364-79715386 CAGAGAGACCCAGGTGGTGATGG + Intronic
1122920317 14:104877279-104877301 GAGAGGGTCCCCGGGGTTGTTGG + Intronic
1123178231 14:106442454-106442476 GAGAAAGGGCAGGGGGTTGATGG - Intergenic
1125581128 15:40786617-40786639 TAGAGAGACCAGGGGATTTAGGG - Intronic
1126798892 15:52282560-52282582 GAGAGAGGCCCGGTGGATGCAGG + Intronic
1127206450 15:56725053-56725075 GAGAGAGGCCTGGGGGTTTTAGG - Intronic
1129377075 15:75140487-75140509 GACAGAGAGCCGGAGGTGGAAGG + Intergenic
1129910337 15:79221370-79221392 GAGAGAGGCCCAGAGTTTGAGGG - Intergenic
1131311126 15:91290928-91290950 GCGAGAGCCCCGGGGTTTCAGGG + Intronic
1131568345 15:93506567-93506589 GAGGGAGACCAGGGGGCTGAGGG - Intergenic
1133036282 16:3036030-3036052 GCGAGAGACCCGGGAGGTCAGGG - Intronic
1134414176 16:14029721-14029743 GAGACAGACACGGGGGGTGGAGG - Intergenic
1137948979 16:52764024-52764046 AAGAGAGAGCCGGGAGTTGGAGG - Intergenic
1138927653 16:61612032-61612054 GAGAGAAACCCTGTGGTTCAGGG + Intergenic
1140210127 16:72962965-72962987 GAGAGAGAGCCGGCTGTTGCGGG - Intronic
1140686208 16:77435652-77435674 GAGAGAGATCCGGGAGAAGAGGG - Intergenic
1141462108 16:84183717-84183739 GGGAGAGGCCCAGGGGTTGCCGG + Exonic
1143373973 17:6456681-6456703 GAGAGTGACCCGCGGGTAGAGGG - Intronic
1147978259 17:44260068-44260090 CAGAGAGACCCTGGGATGGAAGG + Intronic
1148487170 17:47997934-47997956 GAGAGAGACTTGGGGGAAGAGGG + Intergenic
1148755232 17:49969684-49969706 GAGAGAGCGCCGCGGGTTGCTGG - Exonic
1152358832 17:79820608-79820630 GAGAGTGACCTGGGGGCCGAGGG + Intergenic
1153719817 18:7890388-7890410 GAGAGAGAAATTGGGGTTGATGG - Intronic
1156007307 18:32457863-32457885 GACATAGATCCAGGGGTTGATGG - Intronic
1156478702 18:37422686-37422708 GAGAGAGAGCCCTGGGTTTAGGG + Intronic
1159953354 18:74501837-74501859 GAGGGGGAGCCGGGGGTTGGGGG - Intronic
1161851455 19:6739908-6739930 GAGAGAGAGCGGAGGGTGGAGGG - Intronic
1161989841 19:7678416-7678438 GAGGGAGACCCGTGGGGTCATGG + Intronic
1162860991 19:13505836-13505858 GAGAGAGACCCGGGGGTTGATGG - Intronic
1162971237 19:14182650-14182672 GAGGGAGGGCCGGGGGTGGAAGG + Intronic
1165081045 19:33306104-33306126 GGGTGAGACCCTGGGGTCGATGG + Intergenic
1165675414 19:37718717-37718739 GAGAGAGACCTGGGGGACGGTGG - Intronic
1165924385 19:39318276-39318298 GAGAGAGACATGGGGGGTGATGG - Intergenic
1167315883 19:48762425-48762447 GACAGAGACCCGGGGAGTGGGGG + Intergenic
1167762995 19:51461161-51461183 GAGAGAGACCCTGTGTGTGAGGG + Intergenic
1167854034 19:52223856-52223878 GATAGAGACCCAGGAGTGGAAGG - Intronic
1168258239 19:55178938-55178960 GAGCAAGACCCGGGGGTGGGGGG - Intronic
1168258935 19:55182027-55182049 GAGAGAGAGTCGGCCGTTGATGG - Exonic
1168287047 19:55340290-55340312 GGGAGAGACCTGGGGGTGCAGGG - Intronic
1168645388 19:58056079-58056101 GGGAGAGAGCCTGGGGCTGATGG - Intergenic
925421581 2:3717214-3717236 GAGAGAGACCTGGGGGTCTTTGG - Intronic
926105259 2:10145940-10145962 GAGCGAGACCCAGGGGGTGGGGG - Intronic
926870080 2:17406830-17406852 GAGAGGGACCCGGTGGGAGATGG + Intergenic
927215324 2:20665391-20665413 GGGAGAGACCGGGGGGCTGGCGG + Intergenic
931955585 2:67420034-67420056 GAGAGAAACTTGGGGGTTGATGG + Intergenic
932414709 2:71566624-71566646 GGGAGAGAGCCGGGGGTGGATGG + Intronic
932950853 2:76291309-76291331 GAGAGAGCCCAGGGAGTTGGAGG + Intergenic
935347390 2:102121247-102121269 GAGAGAAACCAGGGGGTTGGGGG - Intronic
935433666 2:103004762-103004784 GACAGAGAGCAGGGGGTGGATGG + Intergenic
938570456 2:132557719-132557741 GAGAGAGACCCTAGGGTTGTCGG + Intronic
939084998 2:137708249-137708271 GAGGGAGCCCAGGGGGCTGAGGG - Intergenic
942548621 2:177091451-177091473 GGGAGAGACCATGTGGTTGAGGG - Intergenic
942981756 2:182092335-182092357 GGGAGAGACCCGGTGGGAGATGG - Intronic
943247374 2:185473145-185473167 GAGGGAGGCCAGGGGGCTGAGGG + Intergenic
945143104 2:206708380-206708402 GAGAGAAACCCAGGGTTTTATGG - Intronic
946057634 2:216915917-216915939 AAGAGAGGCCCGGGAGTTGTCGG + Intergenic
946351024 2:219152752-219152774 GAAAGAGATCCCGGGGATGATGG - Intronic
947540876 2:230976965-230976987 GAGACAGAGGCGGGGGTTGGGGG - Intergenic
948308177 2:236965462-236965484 GCCAGAGACACAGGGGTTGAAGG - Intergenic
948939651 2:241189489-241189511 GAGAGAGACCCCCGGGGCGAAGG + Intronic
1168976221 20:1968129-1968151 GAGAGAGAGACAGGGGTCGAGGG - Intergenic
1172054618 20:32145424-32145446 GTGAGAGATCTGTGGGTTGAGGG + Intronic
1172518649 20:35553460-35553482 AAGAGGAACCCAGGGGTTGAAGG + Intronic
1172697940 20:36835291-36835313 GAGGGAGAGCTGGGGGTTGGGGG + Intronic
1174106632 20:48166815-48166837 GAGAGAGGCTGGGGGCTTGAGGG + Intergenic
1174432027 20:50477293-50477315 GAGGGAGACCTGGGGATTGGAGG - Intergenic
1175077106 20:56385015-56385037 GTGAGTGTCCTGGGGGTTGAGGG - Intronic
1176222352 20:63975654-63975676 CAGAGAGGCCTGGGGGCTGATGG - Intronic
1177400246 21:20594291-20594313 GAGAGACACCCTGGGATTTAGGG - Intergenic
1179306277 21:40156202-40156224 GAGAGTGACCCTGGGCTGGAAGG + Intronic
1181782259 22:25201718-25201740 CAGAGAGGCCCGGGGGTTTCTGG + Intronic
1183541938 22:38434498-38434520 CAGAGATGCCGGGGGGTTGAGGG + Intronic
1184035848 22:41917740-41917762 GTGAGAGACCCCGGGGTCCAGGG - Intergenic
1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG + Intergenic
1185109519 22:48893328-48893350 CAGAGAGACCTGGGTGTGGACGG + Intergenic
1185266261 22:49905960-49905982 GAGACAGTCCTGGGGGTGGAAGG - Intronic
950924068 3:16722645-16722667 GAGAGAGAGCCTGGGGTCAAGGG + Intergenic
952005837 3:28841559-28841581 GAGATAGAACCTGGGGTGGAGGG - Intergenic
953169648 3:40495700-40495722 GAGAGAGAACGGGGAGTTTATGG - Intergenic
953510601 3:43534516-43534538 GAGAGAGAGAAGGGGGTTGGGGG + Intronic
954590459 3:51777916-51777938 GAGAGAGACTTGGGGGCTGTGGG - Intergenic
954594593 3:51813975-51813997 GAGAGAGACTCGGGGGCTGTGGG + Intergenic
960985583 3:123278472-123278494 AAGAGAGAAGAGGGGGTTGAAGG + Intergenic
961338854 3:126203787-126203809 GAGGGAGACACGGGGGTTGCAGG + Intergenic
964006314 3:151833546-151833568 TAGAGATCCACGGGGGTTGATGG - Intergenic
965033901 3:163409249-163409271 GAGACATACCCATGGGTTGATGG - Intergenic
970191724 4:13524278-13524300 CAGAAGGACCCGGGTGTTGAAGG + Intergenic
972493364 4:39609480-39609502 GTGTGAGACTTGGGGGTTGAGGG + Intronic
974965820 4:68759822-68759844 GAGAGGGGCCATGGGGTTGAGGG + Intergenic
976256765 4:83108269-83108291 GATAGAGACCCTGGGGGTGAGGG + Intronic
981550429 4:145937127-145937149 GAGAAAGACTGGGGGGTTGGGGG + Intronic
981861229 4:149358927-149358949 GAGAGAGAGACACGGGTTGAGGG + Intergenic
982771847 4:159403645-159403667 CAGAGAGGCCAGGGTGTTGATGG - Intergenic
983171284 4:164539782-164539804 GAGAGAGAGGCAGGGGTTGGGGG + Intergenic
985648627 5:1096932-1096954 GGGAGAGACCCGAGGGTTTCGGG + Intronic
991189265 5:63849752-63849774 GAGGCAGAGCTGGGGGTTGATGG + Intergenic
991578019 5:68125072-68125094 GGGAGAGACCTGGGGGTGGGGGG + Intergenic
994458222 5:100041770-100041792 CAGAGAGAGCAGGGAGTTGAGGG + Intergenic
995186356 5:109275908-109275930 GAGAGAGACATGGGGGTTAGGGG + Intergenic
995465365 5:112445159-112445181 GAGAGAGACGCGGAGGGAGAGGG + Intergenic
995600768 5:113792965-113792987 AAGAGAGAACTGGAGGTTGAGGG + Intergenic
997218258 5:132133246-132133268 GAAAGAAAGCCGGGGGTGGAGGG - Intergenic
997298935 5:132788214-132788236 GAGAGAGAGACAGGGGTTGGGGG + Intronic
997735637 5:136210670-136210692 GAGAGAGACCCAAGGGCAGATGG - Intergenic
998370356 5:141656676-141656698 GGGAGAGACCTGGGGGATGCTGG + Intronic
999125362 5:149242225-149242247 GGAAGAGACCTGGGGCTTGAAGG - Intronic
999717432 5:154372696-154372718 GAGGGAGCTCCGGGGGTTGTTGG + Intronic
1000490894 5:161912244-161912266 GAGAGAGAATCGGCGGTTGGGGG + Intergenic
1002019550 5:176354227-176354249 GAGAGAGACACTGGGGCTCAGGG + Intronic
1004446219 6:15701394-15701416 GAGAGAGACTGTGGGGTTGGAGG + Intergenic
1006183596 6:32168197-32168219 GAGAGAGATCTGGGTGTTGGTGG - Exonic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1011743428 6:90386365-90386387 GAGAGAGCCCCAGGGGATCAAGG + Intergenic
1012429151 6:99146075-99146097 GACAGAGACACTGGGGGTGAAGG + Intergenic
1012939547 6:105402734-105402756 GGGAGGGACGCGGGGGTCGAAGG + Intronic
1014640217 6:123900022-123900044 GAGAGGGACCATTGGGTTGAGGG - Intronic
1015549994 6:134402309-134402331 GAGAGAGAGCAAGGGCTTGAAGG - Intergenic
1015640720 6:135328575-135328597 GAGAGAGACCTGGTGGTAGGGGG - Intronic
1017723210 6:157258762-157258784 GAGAGTTTCCAGGGGGTTGAGGG + Intergenic
1018222779 6:161597596-161597618 GAGAGAGAGTCGGGGGTGGAGGG - Intronic
1019103304 6:169649594-169649616 GTGGGAGCCCCGGGGGATGAGGG - Intronic
1019733201 7:2638523-2638545 GAGGGAGCCCCGGGGGGTGTGGG + Intronic
1020211054 7:6158551-6158573 GAGAGAGAGCTGGGGGTTGCGGG + Intronic
1024554089 7:50588548-50588570 GAGAAAGACACTGGGGTTGGTGG - Intergenic
1026895984 7:74010353-74010375 GAGAGAGCCCCAGGAGTTCAGGG + Intergenic
1026896676 7:74013553-74013575 GAGAGAGCCCCAGGAGTTTAGGG + Intergenic
1027682030 7:81233366-81233388 GAGGGAGGCCAGGGGGCTGAGGG - Intergenic
1029384478 7:100234464-100234486 AACAGGGACACGGGGGTTGAGGG - Intronic
1031877846 7:127162328-127162350 GAGAGAGAGGCGGTGGCTGAGGG - Intronic
1032608996 7:133390539-133390561 GGGAAAGACCTTGGGGTTGAAGG + Intronic
1035211555 7:157332396-157332418 CAGGGAGCCCCGGGGGTTGAGGG - Intergenic
1037703388 8:21295542-21295564 GAGAAAGAGCCGGGGGGAGAGGG - Intergenic
1039785384 8:40830147-40830169 CAGAGAGACCTGGGGCTTCATGG + Intronic
1042748648 8:72134362-72134384 CGGAGAGACCCTGGGGTTGTTGG + Intergenic
1044068226 8:87723787-87723809 GAGAGAGAACCTGGGGTTGCCGG + Intergenic
1049766722 8:144358504-144358526 GAGAGGAACCGGGGGGTTGTCGG - Exonic
1050512034 9:6406364-6406386 GAGAGAGAGACGGGGGTCGGGGG + Intergenic
1055359949 9:75478800-75478822 GAGAGACACTGGGGGGTTGGGGG - Intergenic
1057382066 9:94577141-94577163 GAGATACACCCGGGTGGTGAGGG + Intronic
1059655418 9:116353356-116353378 GGGAGAGAACCTGGGGCTGAAGG + Intronic
1060546536 9:124465173-124465195 GAGAGAGACCAGGAGGATGGAGG - Intronic
1061412830 9:130430500-130430522 GAGAGAGACCCAGGCGTGGTAGG - Exonic
1062417957 9:136462913-136462935 GAGAGAGACCGAGAGGTTCAGGG - Exonic
1185534213 X:846657-846679 GAGAAGGACTTGGGGGTTGAGGG + Intergenic
1187359344 X:18610223-18610245 GAGAGAGACCTGGGGGGTGGGGG - Intronic
1191749026 X:64521031-64521053 GAAAGAGACCCGGTGGGAGATGG + Intergenic
1191843535 X:65529792-65529814 GAGAGAGACCTGGGAGTTGGAGG - Exonic
1193380341 X:80809797-80809819 GAGAGAGACGCGGGGGGTGGGGG + Intergenic
1198253589 X:134905465-134905487 GAGAGAGAAATGGGGGTGGAAGG + Intronic
1198443184 X:136684555-136684577 GAGAGAAGCCCGGGGGGTGGGGG - Intronic
1199241243 X:145550178-145550200 GGGAGAGTCCCTGGGGGTGAGGG - Intergenic
1199818653 X:151423052-151423074 GAAAGAGACTCAGGGGTTGCAGG - Intergenic
1200142253 X:153908078-153908100 GAGAGTGACCTGGAGGCTGAGGG - Intronic