ID: 1162864715

View in Genome Browser
Species Human (GRCh38)
Location 19:13536778-13536800
Sequence CAAATTTCACAGGGAGCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162864715_1162864720 -5 Left 1162864715 19:13536778-13536800 CCCGGTGCTCCCTGTGAAATTTG 0: 1
1: 0
2: 2
3: 9
4: 184
Right 1162864720 19:13536796-13536818 ATTTGGATTCCTGTATTCAGTGG 0: 1
1: 0
2: 1
3: 16
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162864715 Original CRISPR CAAATTTCACAGGGAGCACC GGG (reversed) Intronic
901186063 1:7374119-7374141 CAAATTGCCCAGGAAGCAGCCGG + Intronic
902937514 1:19775024-19775046 CATCTTACACAGGGCGCACCTGG + Intronic
902953859 1:19910868-19910890 CATATTACACAGGTAGCATCAGG + Exonic
905930024 1:41780316-41780338 CAAGTGCCAAAGGGAGCACCAGG + Intronic
911533889 1:99078251-99078273 CACATGTTTCAGGGAGCACCAGG + Intergenic
911586603 1:99698319-99698341 CAAAATTGACAGGGACCACTGGG - Intergenic
911861880 1:102961909-102961931 CACTTTTCCCAGGGTGCACCTGG - Exonic
916096550 1:161356702-161356724 CAAAGTTCCCAGGGAGTAACAGG - Exonic
916692176 1:167201115-167201137 CAAATCTCACAGAGAGGACTTGG - Intergenic
917632113 1:176900620-176900642 CAAATTACACAGTTAGCAACTGG - Intronic
919143468 1:193603031-193603053 AATATTTCACTGGGAGAACCCGG - Intergenic
921069646 1:211648576-211648598 CCAAGTTCACTGGGAGCAGCTGG - Intergenic
924901264 1:248403194-248403216 GTAACTTCACTGGGAGCACCTGG + Intergenic
1065503016 10:26400343-26400365 CCAACTCCACAGGGAGCAACTGG + Intergenic
1066180055 10:32953054-32953076 CTAATTTCACAGATAGTACCTGG - Intronic
1072090095 10:92118921-92118943 CAAAGTTCCCAGGGAGTAACAGG - Intronic
1072439748 10:95443538-95443560 TAAAATGCAAAGGGAGCACCTGG - Intronic
1073298380 10:102455179-102455201 CACATGTCTCAGGGAGCACAGGG + Intergenic
1074524354 10:114251300-114251322 GACATTTCACAGGGAGCATTGGG + Intronic
1074895156 10:117770950-117770972 CAAAATGCAGAGGGAGCAGCTGG + Intergenic
1077014871 11:395009-395031 CTAATTCCTCAGGGAGCCCCTGG - Intronic
1077159277 11:1105313-1105335 CCCATCTCACAGGGAGTACCAGG + Intergenic
1077353866 11:2105701-2105723 CAGATGTCACAGGGAGCTCTCGG - Intergenic
1077581521 11:3420399-3420421 CAGATGTCGCAGGGTGCACCTGG + Intergenic
1077742791 11:4865854-4865876 GACATTTTACAGGGAGAACCTGG + Intronic
1079084541 11:17435893-17435915 CAAAGTTCCCAGGGAGTAACAGG + Intronic
1080703933 11:34670203-34670225 CAAATTACACATGGTGCCCCAGG - Intergenic
1082709071 11:56530761-56530783 CTAATTTCACACTGAGCAGCAGG + Intergenic
1084231669 11:67758023-67758045 CACATGTCTCAGGGAGCACAGGG - Intergenic
1084833975 11:71789608-71789630 CAGATGTCGCAGGGTGCACCTGG - Intronic
1085409487 11:76282810-76282832 CATAATTCCCAGGGAGCAGCTGG + Intergenic
1086228788 11:84543794-84543816 AAAAATTCAAATGGAGCACCTGG - Intronic
1089517096 11:119040045-119040067 CACATGTCTCAGGGAGCACAGGG + Intergenic
1090262930 11:125334538-125334560 CAAATCTCACAGGCAGCAAATGG - Intronic
1092409126 12:8240858-8240880 CAGATGTCGCAGGGTGCACCTGG + Intergenic
1096508335 12:52111595-52111617 AAAATATCACAGGGTGTACCTGG + Intergenic
1100748095 12:97667589-97667611 CAAAGTTCTCAGGGAGGACAGGG + Intergenic
1101900988 12:108790965-108790987 CCAATTTCTCAGTAAGCACCAGG + Intronic
1105016851 12:132791396-132791418 CAAATGTTACAGAGAGCTCCAGG + Intronic
1108215683 13:48181945-48181967 CAGATTTGACAGTGATCACCTGG + Intergenic
1108505006 13:51104965-51104987 CAAACTCCACAGGGAGCAATCGG + Intergenic
1110032876 13:70639138-70639160 GAAATTTAACAGGGAGAAACAGG + Intergenic
1110927325 13:81170319-81170341 CAAATTTAACAAGGAGTACAAGG + Intergenic
1111955846 13:94757730-94757752 CAAATTGTTCAGGGAGCTCCAGG - Intergenic
1112235176 13:97629537-97629559 CAGATCTCAGAGGGAGCACAGGG - Intergenic
1112703443 13:102038431-102038453 AACATTTTCCAGGGAGCACCCGG + Intronic
1113228424 13:108183981-108184003 CCATTTTCACAAGGAACACCTGG + Intergenic
1113872299 13:113566731-113566753 CATATTTCACAGGGAGACACAGG - Intergenic
1116029999 14:39560123-39560145 AAAATTTAACAGAGAGAACCAGG - Intergenic
1124514255 15:30352776-30352798 GAAATTTCACCGGGAGTACGCGG + Intergenic
1124728664 15:32177988-32178010 GAAATTTCACCGGGAGTACGCGG - Intergenic
1124890456 15:33727203-33727225 CAAATGTCACAGGTAGCACTGGG - Intronic
1128706787 15:69842570-69842592 CCAGCTTCCCAGGGAGCACCGGG + Intergenic
1131435285 15:92417006-92417028 CAAACTCCACAGGCAGCAACTGG + Intronic
1131854464 15:96578870-96578892 CCATTCTCACTGGGAGCACCAGG + Intergenic
1133350091 16:5095667-5095689 CAGATGTCGCAGGGTGCACCTGG + Intronic
1134209009 16:12260399-12260421 CAAAGTCCTCAAGGAGCACCAGG - Intronic
1140779527 16:78282033-78282055 CAAAAGCCACAGGGAGAACCAGG + Intronic
1141073279 16:80978089-80978111 TAAATTACACATGAAGCACCAGG + Intronic
1143116935 17:4586260-4586282 GACATTTCACACGGAGCACTGGG - Intronic
1147846913 17:43410936-43410958 CAAAACTCACAGTCAGCACCGGG + Intergenic
1148547673 17:48529994-48530016 CAAAGTTCCCAGGGACCACCAGG + Intronic
1149543377 17:57485253-57485275 CAAGTTTCACAGCGAGGAACAGG + Intronic
1150686830 17:67327656-67327678 CACATGTCTCAGGGAGCACAGGG + Intergenic
1154399823 18:14025812-14025834 CAAAAGCCACAGGGAGCAGCTGG - Intergenic
1156103416 18:33626656-33626678 CAACCTTAACAGGCAGCACCAGG + Intronic
1158845108 18:61433743-61433765 CAAATATAACAGCAAGCACCAGG - Intronic
1159115214 18:64105794-64105816 GAAATGACACAGGGAGAACCTGG + Intergenic
1160370096 18:78364937-78364959 CAGCTTTCACAGGGGACACCTGG - Intergenic
1161475195 19:4480792-4480814 CAAGATTCACAGTGAGCACAGGG - Intronic
1162096803 19:8314985-8315007 CACATGTCTCAGGGAGCACAGGG - Intronic
1162864715 19:13536778-13536800 CAAATTTCACAGGGAGCACCGGG - Intronic
1163917002 19:20248622-20248644 CACATGTCTCAGGGAGCACAGGG + Intergenic
1164154315 19:22580929-22580951 CACATGTCTCAGGGAGCACAGGG - Intergenic
1165814286 19:38631941-38631963 CACATGTCTCAGGGAGCACGGGG + Intronic
1165907681 19:39203727-39203749 CGACTGTAACAGGGAGCACCAGG - Intronic
1167688559 19:50971213-50971235 CAAATGTGAGAGGGAGCACCCGG - Intergenic
926075019 2:9935527-9935549 CAAATGTCACAGGAAGCCACTGG + Intergenic
926884467 2:17584643-17584665 GAAACTTCACTGGGAGCAGCTGG + Intronic
927716120 2:25354428-25354450 CACCTTTCAAAGGGAACACCTGG + Intergenic
927891095 2:26749998-26750020 CACATGTCTCAGGGAGCACAGGG - Intergenic
928238691 2:29568127-29568149 CATATGTCACTGGGAGCAGCAGG + Intronic
931933155 2:67164363-67164385 CAAATATCACATTGAGCAACAGG - Intergenic
932463222 2:71896774-71896796 CAAATTACACAGTGAGCAGGTGG - Intergenic
933242057 2:79932925-79932947 CAAAGATCACAGGGATCAACAGG - Intronic
933700994 2:85255505-85255527 CAGCTTTCCCAGGGAGCCCCAGG + Intronic
936017052 2:108967282-108967304 CATATTTCACAGGGAAAAACAGG + Intronic
937042464 2:118833216-118833238 CACATTACACAGGGAGAGCCAGG - Intergenic
938246665 2:129782411-129782433 CAGATTTCACAGGCAGCAGGTGG - Intergenic
942106549 2:172639370-172639392 CAAACTTCACAGGAAGAACAGGG - Intergenic
944509146 2:200447128-200447150 CAAATATCACAGTGGGGACCAGG + Intronic
944666185 2:201961459-201961481 GAGATGTCACAGAGAGCACCTGG + Intergenic
945959108 2:216113794-216113816 CAATTTTCACATGAAGCAGCTGG + Intronic
948974577 2:241456615-241456637 CACATTTTACAGGAAGCGCCTGG + Intronic
1169188185 20:3637736-3637758 CACATTTCAGAGGGAGGACACGG + Intronic
1169806386 20:9563813-9563835 CAAATCTCACAGAGAGTTCCAGG - Intronic
1170435232 20:16319752-16319774 CCAACTTCACAGTGAGAACCTGG - Intronic
1170797951 20:19566058-19566080 CAAATTCCAGAAGGAGTACCAGG + Intronic
1171197715 20:23214009-23214031 CAGATTTCACAGGAATCATCTGG - Intergenic
1172284484 20:33731533-33731555 CAACTGTCACAGGGATCTCCAGG - Intergenic
1174446156 20:50592688-50592710 CTAATTTCACAGGGAGCTCCTGG + Intronic
1175474877 20:59265123-59265145 CAACTTTCTCAGGTAGCCCCAGG - Intergenic
1179246320 21:39637122-39637144 TAAATTTCACAAGGATTACCTGG + Intronic
1179878511 21:44283662-44283684 CACATGTCTCAGGGAGCACAGGG + Intergenic
1182810550 22:33112501-33112523 CAAATATCACAGGGCGCATTCGG + Intergenic
949959433 3:9299938-9299960 CAAATTTCTCAGGGCTCACAAGG + Intronic
954579781 3:51696958-51696980 CATCTCACACAGGGAGCACCAGG - Intronic
955112513 3:55962961-55962983 CAAACTTCACAGGACGCCCCTGG + Intronic
956256958 3:67293298-67293320 CATATTTGACAGGGTGCTCCTGG - Intergenic
957048298 3:75393327-75393349 CACATGTCTCAGGGAGCACAGGG - Intergenic
957420677 3:79965635-79965657 CAAATTTGTCAGGGAACAACAGG + Intergenic
961300457 3:125918689-125918711 CAGATGTCACAGGGTGCACCTGG - Intergenic
961621315 3:128227104-128227126 CACATTTCAGAAGGAGCAGCAGG - Intronic
961888054 3:130109389-130109411 CAGATGTCGCAGGGTGCACCTGG + Intronic
962253820 3:133856779-133856801 CAATGTTCAGAGGGAACACCTGG + Intronic
962270483 3:133974626-133974648 CACATCTTCCAGGGAGCACCAGG - Intronic
962899465 3:139746524-139746546 CAATATTCACAGTGAGAACCTGG - Intergenic
964608173 3:158581278-158581300 CAATATTCACTGGGAGAACCTGG - Intronic
966330516 3:178807167-178807189 CAAATTTCTGAGAGAGGACCAGG + Intronic
967390470 3:188949334-188949356 CTAATTTCCTAGAGAGCACCAGG - Intronic
967871883 3:194236620-194236642 CAATATTCAATGGGAGCACCAGG - Intergenic
968226697 3:196976914-196976936 CAAAGTTCCCAGGCAGAACCAGG + Intergenic
968687104 4:1968367-1968389 TAATGGTCACAGGGAGCACCGGG + Intronic
968868560 4:3228868-3228890 CATATTCCACAGGAAACACCGGG + Exonic
968884531 4:3320553-3320575 CAAATCCCACACGGAGCGCCAGG - Intronic
968992758 4:3925777-3925799 CACATGTCTCAGGGAGCACAGGG - Intergenic
969822719 4:9732584-9732606 CACATGTCTCAGGGAGCACAGGG + Intergenic
969956590 4:10897383-10897405 CAGGTTTCACAGGGAAGACCTGG - Intergenic
971355367 4:25890405-25890427 CTGACTTCACAGGGAGCTCCCGG - Intronic
972320287 4:37967065-37967087 CGAATTGCACAGCAAGCACCTGG - Intronic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
975381778 4:73708586-73708608 ACAATTTCACAGGGAGAACTGGG + Intergenic
977042013 4:92027998-92028020 CAAATTTCCCAGGGACCCACTGG + Intergenic
978451070 4:108834380-108834402 CAAATCACACAGGGAGCATCTGG - Intronic
979450979 4:120870734-120870756 CAAATGTCACACGGAGCCCAAGG - Intronic
983113658 4:163784525-163784547 CAAGTTTGTCATGGAGCACCAGG + Intronic
986600180 5:9465199-9465221 AAAGTTTCACAGGGATCATCTGG - Intronic
986911994 5:12568893-12568915 CACATTTCAAAGGCAGGACCAGG - Intergenic
993393109 5:87345560-87345582 AAATTTACACAGGGAGCACCAGG + Intronic
995538396 5:113160165-113160187 CAGCTTTCACAGTGAGTACCTGG - Intronic
996588488 5:125118550-125118572 GAAATTTCAAAGGGAGAATCAGG + Intergenic
998735387 5:145133196-145133218 CCAATTTCATTTGGAGCACCAGG + Intergenic
1000731854 5:164844519-164844541 CAAAAGGCACAGGGAGCAACTGG - Intergenic
1001777421 5:174339075-174339097 GAAATTCCCCAGGGAGCAGCTGG - Intergenic
1002272309 5:178080608-178080630 CAAATGTGAAAGAGAGCACCAGG - Intergenic
1003143890 6:3493679-3493701 CAAATTTTACAGGGAACAAGAGG - Intergenic
1003186406 6:3835227-3835249 GAAATTTCACAGGGAGCTCCAGG + Intergenic
1005453757 6:25999366-25999388 CATATGTCTCAGGGAGCACAGGG - Intergenic
1006108166 6:31729023-31729045 CAAAGCTCAAAGGGAGCACGGGG - Exonic
1007994236 6:46289114-46289136 CTAGTTTAACAGGGAGCACAGGG + Intronic
1008475311 6:51929937-51929959 CAAATTTCTCAGGGAGAAACTGG + Intronic
1009930473 6:70171952-70171974 CATATTTAACAGGGAGAGCCTGG + Exonic
1010120011 6:72364417-72364439 CACATTTCACAGGTAGCATGCGG - Intronic
1011889574 6:92140604-92140626 GAAGTTTCACAGAGAGTACCTGG + Intergenic
1012098249 6:94993737-94993759 CAAAGTTCCCAGGGAGCAACAGG + Intergenic
1012113263 6:95262166-95262188 CAAATTTGGCAGGGCGCATCTGG - Intergenic
1015302293 6:131667536-131667558 CCAATTTCTCAGATAGCACCTGG + Intronic
1016212109 6:141549947-141549969 GAAATTTCACAGGGAGGCACAGG - Intergenic
1017402405 6:154079204-154079226 GACATTTCACAGGGTGCCCCAGG + Intronic
1017984863 6:159435141-159435163 CCATCTTCACAGTGAGCACCTGG + Intergenic
1020315406 7:6902131-6902153 CACATGTCTCAGGGAGCACAGGG - Intergenic
1025032581 7:55570006-55570028 CAAATTTCCCAGGTTGCAGCCGG + Intronic
1029001117 7:97155506-97155528 CAAAGTTCAGTGGGAGCACTTGG - Intronic
1030520272 7:110589686-110589708 CAAATTTCACTGGAATCACAAGG + Intergenic
1031384297 7:121128177-121128199 CATATCTGACAGGGAGGACCTGG - Intronic
1031939735 7:127775597-127775619 CTAATTTCACTGGGGGAACCAGG - Intronic
1031953561 7:127917821-127917843 CAAATTTCACATGCAGCTTCAGG + Intronic
1034922625 7:155096581-155096603 CACATGTTACAGAGAGCACCGGG + Intergenic
1036380047 8:8230668-8230690 CAGATGTCGCAGGGTGCACCTGG - Intergenic
1036849512 8:12191994-12192016 CAGATGTCGCAGGGTGCACCTGG + Intronic
1036870874 8:12434267-12434289 CAGATGTCGCAGGGTGCACCTGG + Intronic
1037387277 8:18356832-18356854 CAATTTTCACAGTGAGAACTTGG + Intergenic
1039916183 8:41862003-41862025 CAAATTTTACAAATAGCACCAGG + Intronic
1040681802 8:49819941-49819963 CTAATTGCATAAGGAGCACCTGG + Intergenic
1041838783 8:62246602-62246624 CAAGTTTCAGAGGCAGCACAGGG + Intergenic
1042693366 8:71528445-71528467 CAAAGTTCACATTGGGCACCAGG - Intronic
1042778264 8:72460111-72460133 CAAAATTCACTGTGAGGACCTGG + Intergenic
1043528478 8:81122879-81122901 CAAAGTGCACAGGCAGCACCTGG - Intergenic
1046941248 8:119933598-119933620 CCATTTTCAGAGGGAGCATCTGG + Intronic
1048681140 8:136843007-136843029 CACATTTTTCAGGGAGCAGCAGG - Intergenic
1051070506 9:13160584-13160606 CCAGTTTGACAGGAAGCACCAGG + Intronic
1052817113 9:33110256-33110278 CAAGTTACACTGTGAGCACCTGG + Intronic
1055658922 9:78481689-78481711 CGATTTTCACAGTGAGAACCTGG + Intergenic
1058119108 9:101119074-101119096 CAAATTGGACATGCAGCACCAGG + Intronic
1059685895 9:116635668-116635690 CAAAAATCAGAGGGAACACCAGG - Intronic
1059761331 9:117340444-117340466 AAAATTTAGCAGGGTGCACCGGG - Intronic
1061629173 9:131860794-131860816 GTGATTTCACAGGGAGCAGCAGG + Intronic
1203377823 Un_KI270442v1:391197-391219 CACATGTCTCAGGGAGCACAGGG + Intergenic
1185657058 X:1694015-1694037 CAAAATTCACCGTGAGTACCAGG + Intergenic
1188472600 X:30557371-30557393 CCCATCTCACAGGGAGCCCCTGG - Intergenic
1188527189 X:31099420-31099442 CCAATTCCACAGGGAGCTCTAGG + Intronic
1189247830 X:39577045-39577067 CAAAATTCAAAGGGTGCTCCGGG + Intergenic
1192880452 X:75277525-75277547 TAAATATCACATGGAGCCCCTGG + Intronic
1198194702 X:134348407-134348429 CAAATTTCAGAGGTAGGACTAGG - Intergenic
1201312666 Y:12611117-12611139 GAAATTTCACAGGGAGGAGGGGG - Intergenic
1202019603 Y:20450854-20450876 CAGAATTCCCAGGGTGCACCTGG + Intergenic