ID: 1162870005

View in Genome Browser
Species Human (GRCh38)
Location 19:13579170-13579192
Sequence ACTTGAAAGCAGAAGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 351}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162870005 Original CRISPR ACTTGAAAGCAGAAGCTGCA AGG (reversed) Intronic
900944107 1:5820017-5820039 TCTTGAGGGCAGAAGCTACAAGG + Intergenic
902632134 1:17711230-17711252 GCATGAAAGCAGAAGCTGCCAGG - Intergenic
903837273 1:26213144-26213166 ACTTAAGAGCAGATGCTGCTAGG - Intergenic
904177792 1:28643218-28643240 AGTTAAAAGCGCAAGCTGCAGGG - Intergenic
904385359 1:30138222-30138244 ATTTGAAAGCAGACTCTTCAAGG + Intergenic
905326207 1:37153699-37153721 AGTTGAAGGCAGATGATGCAGGG + Intergenic
907849792 1:58245249-58245271 AAGTGAAAGCAGAAGGTGCCTGG + Intronic
908025852 1:59950910-59950932 GGGTGAAAGCAGAAGCTGCCAGG + Intergenic
910697007 1:90029983-90030005 ACTTGAAAACAGAAGTTGAAAGG - Intronic
911216757 1:95203332-95203354 ACTGGGAGGCAGAGGCTGCAGGG - Intronic
911295592 1:96110993-96111015 ATTTGAAAGGAGAAGGTACAAGG + Intergenic
911450803 1:98058047-98058069 AGTTTAAGGCAGAAGCTTCAAGG + Intergenic
911608766 1:99937842-99937864 ACTTGAAAACAGTATATGCAGGG - Intergenic
911800039 1:102125054-102125076 CCTGGAAAGTTGAAGCTGCAGGG - Intergenic
912214712 1:107595339-107595361 CCTTGAAAGCAGAAACTGAAAGG - Intronic
913582271 1:120238119-120238141 TCTTTAAAGCAGAAGGTGTAGGG - Intergenic
913625904 1:120660265-120660287 TCTTTAAAGCAGAAGGTGTAGGG + Intergenic
914564205 1:148849597-148849619 TCTTTAAAGCAGAAGGTGTAGGG - Intronic
914608621 1:149280642-149280664 TCTTTAAAGCAGAAGGTGTAGGG + Intergenic
916593713 1:166221013-166221035 ACTTGAAGGCAGAAGGTGGGAGG - Intergenic
916843369 1:168623675-168623697 ATTTGAAAGAATCAGCTGCACGG - Intergenic
917398231 1:174617549-174617571 ACCTAAAAGTAGAAGATGCATGG - Intronic
918001300 1:180500028-180500050 GCTTGAAGCCAGAAGCTTCAAGG + Intronic
918403316 1:184186772-184186794 AATTGAAAGCAGAATCTGGATGG + Intergenic
919111758 1:193228694-193228716 ACTTAAAAGCTGAAACTGTAAGG + Intronic
920491224 1:206416817-206416839 AGTGGAAGGGAGAAGCTGCAGGG + Intronic
921022616 1:211249988-211250010 TCTTGGAGCCAGAAGCTGCATGG + Intergenic
922291332 1:224211211-224211233 AGTTGAAATTAGAAACTGCAAGG - Intergenic
923719601 1:236455650-236455672 ACTGGAATGCAATAGCTGCAAGG - Intronic
924014045 1:239700600-239700622 ACTTAAAGGCATATGCTGCAGGG - Intronic
924428837 1:243979325-243979347 ACTGTACAGCAGAAGCTGCTTGG - Intergenic
1063099686 10:2938666-2938688 ACTAGGAAGGAGAAGCTGTAAGG - Intergenic
1065005185 10:21373184-21373206 ACATGAGAGCACAAGCTGCATGG + Intergenic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1066436282 10:35399091-35399113 ACTTGAAAGCATGAGCTGATTGG + Intronic
1068885826 10:62095996-62096018 ACATTAAACCAGAAGTTGCATGG - Exonic
1071369879 10:84940407-84940429 AGATGAAGGCAGCAGCTGCAGGG + Intergenic
1074026455 10:109640837-109640859 ACTTGTAAGTAGAAGCTGGCCGG - Intergenic
1074563908 10:114559301-114559323 ACTAGAAATCAGAATCTTCAAGG - Intronic
1075616282 10:123892526-123892548 CCTGGAGAGCAGAAGCCGCAGGG - Intronic
1076104708 10:127812266-127812288 ACCTGAAAACAGAAGATGCCAGG - Intergenic
1076515790 10:131043807-131043829 CCCTGAAAGCAGAAGTTGTAAGG + Intergenic
1078396949 11:10989548-10989570 ACTCAGAGGCAGAAGCTGCAGGG - Intergenic
1078422313 11:11222794-11222816 ACTTGAAACCAGAAGGTGGAGGG - Intergenic
1079358651 11:19752003-19752025 ACATGAAAGAAGAGGCTCCAAGG - Intronic
1082012854 11:47462055-47462077 GCTTGAAGGCACAAGGTGCAAGG + Intergenic
1083560757 11:63671346-63671368 CCTTCAAAGCAGAAGCAGCAGGG + Exonic
1083762298 11:64825354-64825376 ACAGCACAGCAGAAGCTGCAAGG + Intronic
1084409535 11:68998520-68998542 ACTTGAAAGCAGATTCTTCCCGG - Intergenic
1084984173 11:72852985-72853007 ACTTGAAGGCAGAAGGTGGGAGG + Intronic
1085241472 11:75059980-75060002 ACTTGGGATCAGGAGCTGCAAGG - Intergenic
1085397932 11:76216720-76216742 GGGTGAAGGCAGAAGCTGCAAGG - Intergenic
1085629043 11:78097686-78097708 AACTGCAAACAGAAGCTGCATGG + Intergenic
1085843059 11:80036089-80036111 ACTTGAAAGAAGAATATACAAGG - Intergenic
1087238590 11:95750032-95750054 AAATCAAAGCAGAAGCTGAAAGG - Intergenic
1087865462 11:103221250-103221272 ACATGAAACCTGAACCTGCATGG - Intronic
1091099706 11:132859921-132859943 AATTGAAAGCAGAAAATGAAAGG - Intronic
1091162203 11:133434346-133434368 ACTTAACTTCAGAAGCTGCAGGG - Intronic
1092505237 12:9092107-9092129 ACTGGGAAGCAGAAGGAGCAGGG + Intronic
1092783076 12:12005206-12005228 ACTTGAAAGCAGAAGGATCATGG - Intergenic
1092890046 12:12960888-12960910 AGATCAAAGCAGAAGCTGCAAGG - Intergenic
1093091229 12:14922984-14923006 ACTTGAACCCAGAAGGTGGAGGG + Intronic
1093229951 12:16531822-16531844 AATTGAAATGAGCAGCTGCATGG + Intronic
1094770458 12:33652352-33652374 TCTTGAAGCCAGAAGCTGCATGG + Intergenic
1095815431 12:46417052-46417074 CCTGGGAAGCAGAAGTTGCAAGG - Intergenic
1096269628 12:50154518-50154540 GATTGAATGCAGAAGCTGCTAGG + Intronic
1098197966 12:68022312-68022334 GCCTGAAAGCAGAAGCTGAAAGG - Intergenic
1098328597 12:69328921-69328943 ACTTGAGGGCATTAGCTGCAGGG + Intergenic
1099600143 12:84725159-84725181 ACTTGGAGGCAGAGGTTGCAGGG - Intergenic
1100261035 12:92932206-92932228 ACTTGAAGGCAGGAGGTGGATGG + Intergenic
1100644691 12:96516398-96516420 ACTCAAATGGAGAAGCTGCAGGG + Intronic
1101521120 12:105483383-105483405 ACATGGAAGCAGAATGTGCAAGG + Intergenic
1102563763 12:113781083-113781105 ACTAGAAAGCAGAAGATCCTAGG + Intergenic
1102873532 12:116432358-116432380 AAGTGAAAATAGAAGCTGCAAGG - Intergenic
1103148567 12:118617054-118617076 ACTTAAAAGCAGAAGCTTTGGGG - Intergenic
1103835127 12:123812867-123812889 GCATGAGAGCAGAAGCTGCAGGG + Intronic
1104829461 12:131739889-131739911 ACTCAAAAGGAGAAGCTGTAGGG - Intronic
1105589372 13:21776803-21776825 AGGTGAAGGCAGAACCTGCATGG + Intergenic
1106155512 13:27151697-27151719 ACTTGAGACCAGGAGTTGCAAGG + Intronic
1106525762 13:30539997-30540019 ACTCTAATGCAGAAGCAGCAGGG - Intronic
1107801492 13:44112045-44112067 AGATGACAGCAGAAGCTGCCAGG + Intergenic
1107823966 13:44311009-44311031 ACTTGGCAGCAGAGGCTTCATGG + Intergenic
1107974517 13:45676418-45676440 ACATGAATGCATAGGCTGCAGGG - Intergenic
1108084569 13:46772653-46772675 ACTTATAAGCAGGAGCTGAATGG - Intronic
1110164987 13:72431053-72431075 ACTTGTAAGCAGAGGCTTGAAGG + Intergenic
1111128289 13:83940970-83940992 AACTTAAAGCAGAAGCTGAAGGG - Intergenic
1113675572 13:112204740-112204762 AAATGAAAGGAGAACCTGCACGG + Intergenic
1114748428 14:25176098-25176120 ACTTCAGAGCAGAAGTTGAAGGG + Intergenic
1114938596 14:27576530-27576552 TCTTGAAGGCAGAAGATGGATGG - Intergenic
1114962245 14:27908061-27908083 AATTGAATGGAGAAGCTGGAGGG + Intergenic
1115702582 14:35969151-35969173 ACTTTAAAGCAAATGCTCCAGGG + Intergenic
1116297536 14:43132597-43132619 ACATGAGAACAGAGGCTGCATGG - Intergenic
1117770477 14:59129354-59129376 ACTTAAAAGAAGAAGCTACCAGG + Intergenic
1118444127 14:65836635-65836657 ACTTAAAAGCAGATGCTGTGTGG - Intergenic
1118754260 14:68827225-68827247 CCTGGGAAGCAGAAGTTGCAGGG + Intergenic
1118890170 14:69902531-69902553 GGGTGAAGGCAGAAGCTGCAAGG - Intronic
1118997392 14:70848940-70848962 ACTTGGAGGCAGAGGCTGCAGGG + Intergenic
1119005689 14:70925718-70925740 ATTTGAAAGCATATGGTGCATGG - Intronic
1119987160 14:79150844-79150866 AAATGAAGGCAGAAGCTGCATGG + Intronic
1122291815 14:100684855-100684877 ACTTGGAAGTGGAAGCTTCAGGG + Intergenic
1124887449 15:33700432-33700454 ACTTGAAAACTGAAGTTTCACGG + Intronic
1125445981 15:39756841-39756863 ATGTGAAAGCTGGAGCTGCAAGG - Intronic
1125446041 15:39758018-39758040 ATATGAAAGCTGGAGCTGCAAGG - Intronic
1126559460 15:50027213-50027235 ATTTGACAGCAGTAGGTGCAAGG - Intronic
1126649098 15:50903764-50903786 ACTTGAAAGCTGAACCGGCCTGG - Intergenic
1127094225 15:55496837-55496859 ACTTGAAAGCAGCAAATGCAGGG + Intronic
1127365124 15:58282394-58282416 GGTCAAAAGCAGAAGCTGCAAGG + Intronic
1128320683 15:66691747-66691769 GGTTGAAAGCAGCACCTGCAGGG + Intergenic
1129537000 15:76321766-76321788 ACTTGAAAGGAGAATCGGAAAGG - Intergenic
1131319635 15:91374786-91374808 ACTGGAAAGCAGAATCTGAGTGG - Intergenic
1133587789 16:7212450-7212472 ACTCTAAAGCAGCATCTGCATGG - Intronic
1134533258 16:15001865-15001887 ACTTGAAAAGAGAAGCTGCCAGG - Intronic
1137752372 16:50876155-50876177 ATTTGAAAGATGAAGCTTCATGG + Intergenic
1138730572 16:59189499-59189521 AGGGCAAAGCAGAAGCTGCATGG + Intergenic
1138868882 16:60856556-60856578 ACTTGAAAGCAGGAGAAGCCAGG + Intergenic
1139862774 16:70038874-70038896 ACTTGAAAAGAGAAGCTGCCAGG + Intergenic
1141115681 16:81307036-81307058 ACTTGAAAGCAGAAGCCGGAAGG - Intergenic
1141119591 16:81341951-81341973 AATGGAAAGCAGAAGAAGCAGGG + Intronic
1144123435 17:12179005-12179027 ATTTGTGAGCAGAAGCTACACGG + Intergenic
1145901687 17:28494138-28494160 ACTTGAAGGCAGGGGCTGCCCGG - Intronic
1146389417 17:32407824-32407846 GCTTGACAGCAGCACCTGCAGGG - Intergenic
1146390449 17:32417397-32417419 GCCTGATAGCAGCAGCTGCAGGG + Intergenic
1146593451 17:34149180-34149202 ACTGGAAGGTTGAAGCTGCAGGG - Intronic
1148052878 17:44777791-44777813 AGTTGAAGGCAGAAGCTGGCAGG - Exonic
1148201457 17:45752691-45752713 AGTTCCAGGCAGAAGCTGCAAGG - Intergenic
1150333619 17:64314080-64314102 ACTAGAAAGAGAAAGCTGCAGGG - Intergenic
1150417824 17:65001698-65001720 ACTTGGAAGCAGCAGGTGGAGGG - Intergenic
1150793826 17:68222097-68222119 ACTTGGAAGCAGCAGGTGGAGGG + Intergenic
1151072037 17:71225568-71225590 ATTAGAAAGCAGTAGCTCCATGG - Intergenic
1151107437 17:71633057-71633079 ACTTGAAAGGAACAGGTGCATGG + Intergenic
1151229955 17:72677358-72677380 ACATCACAGCAGATGCTGCAAGG + Intronic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1151848713 17:76676678-76676700 ACTTGAACCCAGAAGGTGAAGGG + Exonic
1153635781 18:7112226-7112248 ACTTGGAAGGACAAGTTGCAAGG + Intronic
1153811456 18:8755574-8755596 CCTGGAACTCAGAAGCTGCATGG - Intronic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1155041506 18:22069118-22069140 ATGTGTAAGCAGAAGCTGTAGGG - Intergenic
1155090462 18:22504253-22504275 ACTTGCAAGCAGAAGATGGTGGG - Intergenic
1155433273 18:25784322-25784344 GCTTGAAACCAGAAACTGGAGGG + Intergenic
1156386415 18:36609265-36609287 ACTTAGCAGCAGAGGCTGCAGGG + Intronic
1156889649 18:42175985-42176007 ACTTGAAAGCATGAGGTGGAAGG - Intergenic
1157190706 18:45579079-45579101 CAGAGAAAGCAGAAGCTGCAAGG + Intronic
1157532371 18:48432228-48432250 AGGCAAAAGCAGAAGCTGCAAGG + Intergenic
1159038351 18:63298886-63298908 CCTTGAAAGCAGCAGCTTCCTGG + Intronic
1160561431 18:79759926-79759948 ACTTGAACCCAGAAGGTGGAGGG - Intergenic
1161746952 19:6066284-6066306 ACATGAAACCAGAAGGTGCTGGG + Intronic
1162231399 19:9270122-9270144 AGTGGAAATCGGAAGCTGCAGGG - Intergenic
1162870005 19:13579170-13579192 ACTTGAAAGCAGAAGCTGCAAGG - Intronic
1164655029 19:29914639-29914661 ACTGGAAAGCTGAAGGGGCAGGG + Intergenic
1165691219 19:37865171-37865193 CCTTGAAAGGAGAAGCTGATTGG + Intergenic
1165954439 19:39493330-39493352 ACTTGAACCCAGGAGGTGCAGGG - Intronic
1165961989 19:39542561-39542583 ACCTTACAGCAGAAGCTGAAAGG + Intergenic
1168133903 19:54337934-54337956 ACCTGACACCAGTAGCTGCAGGG + Exonic
1168662260 19:58176529-58176551 ACTTGAGAGCAAAAGCTGGTGGG - Intergenic
925980789 2:9175606-9175628 ACTGGAAGGCGGAAGTTGCAGGG - Intergenic
926556666 2:14365614-14365636 ACTTGAAAGCAGATTCTGGTTGG + Intergenic
928006867 2:27570402-27570424 ACTTCAAGGCCAAAGCTGCAAGG + Intergenic
929705306 2:44205493-44205515 ACTGGAAAGCAGAAACATCAAGG - Intronic
929745224 2:44650204-44650226 GATTGACAGCAGAAGCTACAAGG - Intronic
930474848 2:51868723-51868745 ACTTGGAATCAGAAACAGCAGGG + Intergenic
930996533 2:57726122-57726144 ACATGAAAGCAGTAGCTGGAAGG - Intergenic
931010363 2:57905341-57905363 ACCCAAAAGAAGAAGCTGCATGG + Intergenic
931171080 2:59804395-59804417 AATTGTAAGCAGAGGCTGCCTGG - Intergenic
931284577 2:60821123-60821145 TCTCCAAAGCAGAACCTGCAAGG - Intergenic
931760642 2:65413647-65413669 ACATCTAAGCATAAGCTGCAGGG + Intronic
933178851 2:79207399-79207421 ACTTGAAGGTAGAAGCAGAATGG - Intronic
934017502 2:87904333-87904355 ACCTGAAGGCAGAAACTGAAAGG - Intergenic
935366028 2:102291961-102291983 ACTAGACAGGAGAAGCTGAAAGG - Intergenic
935940109 2:108229157-108229179 GGTTCTAAGCAGAAGCTGCAAGG + Intergenic
937315969 2:120932327-120932349 AGTGGAAAGCAGGAGGTGCAAGG - Intronic
938423479 2:131164318-131164340 ACTAGAAAGAAAAAGCTGCGTGG - Intronic
938946082 2:136213204-136213226 ACTTGAAAGCAGAAGAAAAATGG - Intergenic
940518052 2:154705912-154705934 AATTGAAAGTAGAAGTTGTATGG + Intronic
941897574 2:170644924-170644946 ATATGAAATCAGAAGGTGCAGGG + Intronic
942694055 2:178618747-178618769 ACCCCAAAGCAGAAGCTGAATGG - Exonic
944906042 2:204263217-204263239 TCTTGAAAGCACGAGCTGAAAGG + Intergenic
946545437 2:220736968-220736990 ACATGACAGCATATGCTGCAAGG + Intergenic
947378129 2:229518077-229518099 ATCTCAAAGCAGAAGCTGGATGG + Intronic
947796646 2:232897252-232897274 GCATGAAAGCAGGAGCTCCAGGG + Intronic
1168895719 20:1322063-1322085 AGTTGAAAGTAGCAGCTGAAAGG - Intronic
1169181778 20:3575260-3575282 TCTAGAAAAGAGAAGCTGCATGG - Intronic
1169432559 20:5551657-5551679 ACTTGAACCCAGGAGCTGGAGGG + Intronic
1169878007 20:10318640-10318662 CAATGAAAGCAGAAGCTGAAAGG - Intergenic
1169896854 20:10513584-10513606 ACTTGAGGGCAGAAGATGCCAGG + Intronic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1171384884 20:24763424-24763446 ACTTGAAGTGAGAAGCTGCTGGG - Intergenic
1172394223 20:34588167-34588189 ACTTGAAACCAGGAGGTGGAGGG + Intronic
1172833214 20:37854662-37854684 CCTTGGAGGCAGAAGTTGCAGGG - Intronic
1176192500 20:63818780-63818802 ACTGGAAGGCAGAGGTTGCAAGG + Intronic
1176311312 21:5151957-5151979 ACCTGAAATCAGAAGCTAGAAGG - Intronic
1177493947 21:21864311-21864333 AGTTGAGGGCAGAAGCTGGAAGG + Intergenic
1178449696 21:32685521-32685543 ACCAGAAGGCAGAGGCTGCAGGG + Intronic
1178697244 21:34804035-34804057 AATGGAAAGCTGAAGTTGCAGGG + Intronic
1179568208 21:42262200-42262222 ACTTCCTAGCAGAGGCTGCAAGG + Intronic
1179607741 21:42528413-42528435 ACCTGAAAGCAGAGGCTTCCCGG + Intronic
1179845738 21:44110078-44110100 ACCTGAAATCAGAAGCTAGAAGG + Intronic
1181264854 22:21625028-21625050 AAATGAAAGGAGAAGCAGCAAGG - Intergenic
1182594618 22:31409468-31409490 CCTTCAAATCAGAATCTGCAGGG + Intronic
1184919401 22:47595090-47595112 ACTTGACAGGAGCAGCAGCAAGG + Intergenic
949373075 3:3356026-3356048 ACTGGAAAGCAGGAGTTGCTGGG + Intergenic
949991204 3:9580695-9580717 ACCACACAGCAGAAGCTGCAAGG - Intergenic
950833668 3:15899506-15899528 ACACAAAAGCAGAAGCTGCCAGG + Intergenic
951117339 3:18880455-18880477 TCTTGAAAGCAGAAGCCAAAAGG + Intergenic
953662124 3:44899010-44899032 GCTTGAAAGGAGAAGCAGCCAGG - Intronic
954526301 3:51274703-51274725 CCTAGAAAGTTGAAGCTGCAGGG + Intronic
954540315 3:51389394-51389416 ACTGGAAAGCAGAAACTGGTAGG - Exonic
956032214 3:65050693-65050715 AAGAGAAAGCAGAAGTTGCAAGG - Intergenic
956204494 3:66741416-66741438 GGGTGACAGCAGAAGCTGCAAGG + Intergenic
956587873 3:70883387-70883409 TCTGCAAATCAGAAGCTGCAAGG + Intergenic
956751550 3:72347775-72347797 AGTTGAGGGCAGAAGCAGCATGG + Intergenic
957253699 3:77809628-77809650 ACTTAAAAGCAGCAGCTGAAAGG + Intergenic
957638002 3:82811867-82811889 ACTTGAAACCAAATGCTGCTTGG + Intergenic
958446147 3:94217501-94217523 AATTGAAAACAGAAGAAGCAGGG + Intergenic
960291928 3:115896492-115896514 AGATGAAATCAGTAGCTGCAAGG + Intronic
961787533 3:129356814-129356836 ACTTGGAAGCTGATGCTCCAGGG - Intergenic
963197536 3:142549607-142549629 GAATGAGAGCAGAAGCTGCAGGG + Exonic
963637043 3:147811044-147811066 GCATGAAAACAGAAGCAGCAAGG - Intergenic
963790820 3:149580687-149580709 ACCGGAAGGCAGAGGCTGCAGGG - Intronic
963863583 3:150335886-150335908 TCTTCAAAGCAGAGGCTGCCTGG + Intergenic
964287126 3:155130415-155130437 ACTGGAGAGTAGAAGCTACAGGG + Intronic
964308271 3:155363501-155363523 ACCTTAAAGCGGAAGCTGAAGGG - Intergenic
965370487 3:167856051-167856073 ACTAGGGAGCAGAGGCTGCAGGG - Intergenic
966458076 3:180141002-180141024 AGTTGAAAGGAGAAGATGGAGGG - Intergenic
966659375 3:182397450-182397472 TCTTGAAAGCTGAAGCTGGGGGG - Intergenic
967313905 3:188132569-188132591 AGTTAAGAGCAGTAGCTGCAAGG + Intergenic
968328978 3:197847760-197847782 ACTTCAAAGCAAAAGTTGCATGG + Intronic
970140591 4:12977791-12977813 ACTTGAAACCAGAAGATCCGTGG + Intergenic
971263476 4:25077426-25077448 ACATGAAATCAGAATCTCCAAGG + Intergenic
971287898 4:25307985-25308007 ACTGGAAGGCAGAGGCTGCCGGG + Intergenic
971942947 4:33238929-33238951 ACTTGAAACCACAAACTACATGG - Intergenic
973810747 4:54567865-54567887 ATTTGAAGGCAGAAGCTGCTTGG + Intergenic
975937856 4:79602820-79602842 ACTTGAAATCAAAAGCTACAAGG - Intergenic
976351779 4:84067972-84067994 ACTTGAAAGTAGAAGGTGTTTGG - Intergenic
976385627 4:84454361-84454383 ACTTGGAAGCAGGAGTTGAAAGG + Intergenic
976460743 4:85309213-85309235 ACTAGAATGCAGAATCTACAAGG - Intergenic
976546268 4:86339051-86339073 ACTTGAAAGCAGAAGCCCTTAGG + Intronic
976595945 4:86894865-86894887 TCTTGGAAGCAGATGCTTCAAGG + Intronic
976694229 4:87901567-87901589 AATTAAAAGCAGATGCTCCATGG - Intergenic
977468289 4:97409444-97409466 AGTTGTGTGCAGAAGCTGCAAGG + Intronic
977506579 4:97911030-97911052 ACCTGGAAGCACAAGCCGCATGG + Intronic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
979611123 4:122689889-122689911 GGTTGAGAGCAGAAGCTGCAAGG - Intergenic
980005192 4:127533627-127533649 ATTTGAACCCAGAAGGTGCAGGG - Intergenic
980339465 4:131524671-131524693 GCTTAAAAACAGAAGCTGTAAGG - Intergenic
980703805 4:136465329-136465351 ACTTGAAAGCAACAGCTTCATGG + Intergenic
981127570 4:141124044-141124066 ACCTTAAAGCAGGAGCTGAAGGG - Intronic
981526477 4:145711154-145711176 ACCTTAAAGCAGAAGCTTTAAGG - Intronic
981676112 4:147344945-147344967 GTGTGAGAGCAGAAGCTGCAAGG - Intergenic
982095883 4:151923053-151923075 AATTAAAAGCAGATGCTGCTGGG + Intergenic
984156754 4:176203778-176203800 GGATGAAATCAGAAGCTGCAAGG + Intergenic
985500436 5:240742-240764 ACTTGGAAGTGGAAGCTGAATGG - Intronic
985842710 5:2320726-2320748 GCTCAAGAGCAGAAGCTGCAGGG - Intergenic
986551826 5:8965018-8965040 ACTTGAAAGTGGAAGGTGGAAGG + Intergenic
987639626 5:20595786-20595808 ACTTGAGAGCATTAGCTGCGGGG - Intergenic
987650185 5:20731035-20731057 CCTTGAAAGCACAGGCTCCAGGG + Intergenic
988357237 5:30193740-30193762 AGCAGACAGCAGAAGCTGCATGG + Intergenic
988745374 5:34130432-34130454 CCTTGAAAGCACAGGCTCCAGGG - Intergenic
989240289 5:39195485-39195507 ACTTGAAACCAAAAGGTGCCTGG - Intronic
989745144 5:44820258-44820280 AGTTGAAAGCAGAAGTTCAAGGG - Intronic
992024440 5:72656722-72656744 ACTTAAAAGAAGAGGCAGCAGGG - Intergenic
993139001 5:84006567-84006589 ACTTGAGAGCAGAGGTTGGAAGG + Intronic
993533925 5:89057628-89057650 ACTAGAAAGCAGATGTTCCAAGG - Intergenic
993852507 5:93028380-93028402 ATGTGAAGGCAGAAGATGCAAGG - Intergenic
995560484 5:113375751-113375773 ACATGAATGAAGAAGCTGCAAGG + Intronic
996068400 5:119106244-119106266 GAGTGAAAGTAGAAGCTGCAAGG + Intronic
997203653 5:132027884-132027906 ACTTGAAAGAAGAAGAAGGAGGG - Intergenic
999756046 5:154665239-154665261 ACTTGAACCCAGAAGGTGGAGGG - Intergenic
1000240000 5:159400547-159400569 AATAGAAAGCAGAACCTGAAGGG - Intergenic
1001269693 5:170302055-170302077 ACAAGAAAGCAGTACCTGCAGGG + Intergenic
1001739524 5:174040260-174040282 ATATGAAATCAGATGCTGCATGG + Intergenic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1001984894 5:176065494-176065516 GCCAGAAAGCAGAAGTTGCAGGG - Intronic
1002207525 5:177573841-177573863 CCTTGGAGGCAGAAGTTGCAGGG + Intergenic
1002232621 5:177778695-177778717 GCCAGAAAGCAGAAGTTGCAGGG + Intronic
1002263371 5:178011113-178011135 GCCAGAAAGCAGAAGTTGCAGGG - Intronic
1002921640 6:1577261-1577283 ATTTGCTAGCAGAAGCTGGAGGG - Intergenic
1004237206 6:13884736-13884758 ACTAGGCAGCAGAAGCTACAGGG - Intergenic
1004845074 6:19632351-19632373 ATTTGAAATGAAAAGCTGCATGG + Intergenic
1005264641 6:24099107-24099129 CCTTGACAGTGGAAGCTGCAAGG - Intergenic
1005543490 6:26838184-26838206 CCTTGAAAGCACAGGCTCCAGGG - Intergenic
1008018714 6:46551221-46551243 AGTTGAAAGAATAAGTTGCAGGG + Intronic
1008439795 6:51520074-51520096 AAGTGCCAGCAGAAGCTGCAGGG - Intergenic
1009014320 6:57880353-57880375 CCTTGAAAGCACAGGCTCCAGGG - Intergenic
1010034361 6:71306344-71306366 ACTAGAATGCAGAAGGAGCAGGG - Exonic
1010225338 6:73483699-73483721 ACTTGAACCCAGAAGCTGGGAGG - Intronic
1010235389 6:73571088-73571110 GCTTAAAAGCAGCAGCAGCACGG - Intergenic
1010456198 6:76058602-76058624 AGTTAAGAGCAGAAGCTGTAAGG - Intronic
1011536894 6:88385520-88385542 CTTTTAAAGCAGAAGCTACAAGG + Intergenic
1015327876 6:131944761-131944783 ATTTGAAAGCACAAGTTGAAAGG - Intergenic
1015409773 6:132880306-132880328 ACTGGAAAGCAAAAGTTGGAAGG - Intergenic
1015863549 6:137705165-137705187 GCTTGAAAGCAGAAGTGGCCAGG - Intergenic
1016763117 6:147762279-147762301 ACTTGAAGACAGAGGTTGCAGGG - Intergenic
1017008695 6:150047162-150047184 ACTTGAATGCAGGAGCTGGCAGG - Intergenic
1019397922 7:833103-833125 AACTGAAAGCAGAAGGGGCAGGG - Intronic
1019539026 7:1543317-1543339 ACTGGAAGGGAGAGGCTGCATGG - Exonic
1021456765 7:20837931-20837953 AATTAAAAGCAGATGCTGGACGG + Intergenic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1022035931 7:26534657-26534679 TCATGAAAGCAAAATCTGCAAGG + Exonic
1022779211 7:33560965-33560987 ACTAGAAAGAAAAAGCTGCCTGG - Intronic
1022856693 7:34321856-34321878 TCGTGAAAGCAGAAGATGGAAGG + Intergenic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1023290375 7:38662117-38662139 TCTTGAAAACAGAAGATGAATGG - Intergenic
1024173406 7:46813005-46813027 TGATGAAAGCAGAAGCTTCAAGG + Intergenic
1025140530 7:56459786-56459808 TCTGGGAAGCAGAAGTTGCAGGG + Intergenic
1025754308 7:64321345-64321367 CCTTCAAAGCAAAAGGTGCATGG - Intronic
1027515157 7:79133028-79133050 ACTGGTAAGCAGAATCTACAAGG - Intronic
1029503526 7:100948811-100948833 GCTTGAAACCAGAAGGTGGAGGG - Intergenic
1030354039 7:108523589-108523611 ACCTTAAAGCAGAAGCTGAAGGG - Intronic
1031774645 7:125892346-125892368 ACTTATAAGCAGAAGCGTCAAGG - Intergenic
1034288496 7:149907750-149907772 ACATTAAAGCAAAAGGTGCAAGG + Intergenic
1034662576 7:152785117-152785139 ACATTAAAGCAAAAGGTGCAAGG - Intronic
1035121298 7:156570114-156570136 ACAGAAAACCAGAAGCTGCATGG + Intergenic
1036162519 8:6402881-6402903 CCTTGCAAGCTGAAGCTGGATGG + Intergenic
1036644085 8:10601325-10601347 AGTTGCAGGCAGAAGCAGCATGG + Intergenic
1036665676 8:10735662-10735684 ACTTGGAACCAGAAGCCACAAGG + Intronic
1037903134 8:22699880-22699902 ACTTGAACCCAGAAGGTGAAAGG - Intergenic
1038117429 8:24573224-24573246 ACTTGATGAGAGAAGCTGCAAGG - Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041372086 8:57172320-57172342 TCTTGAAAGATGAAGCTGGAAGG - Intergenic
1041851492 8:62398169-62398191 AACTAAAAGCAGAGGCTGCAGGG + Intronic
1042653737 8:71071616-71071638 AATTGAAATCAGAAGCTCAAAGG - Intergenic
1042921819 8:73927666-73927688 ACTTGAAACCAGGAGGTGGATGG - Intergenic
1044858314 8:96497439-96497461 TCCTAAAAGCAGAAGCTGAAGGG - Intronic
1045561219 8:103265548-103265570 ACTGGAAAACAAAAGCTCCATGG + Intergenic
1046012914 8:108572117-108572139 ACTAAAAAGCAGTAGCTGAATGG + Intergenic
1046248437 8:111597390-111597412 ACTTTAAAAGAGAAGTTGCATGG + Intergenic
1046843069 8:118883012-118883034 ACTTGTAAGCAGAGGCAGAATGG + Intergenic
1047368421 8:124234345-124234367 ACTTGAAAGAAGAAGAAACAGGG - Intergenic
1047449433 8:124950867-124950889 AGTCGCAGGCAGAAGCTGCAAGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1047902517 8:129439642-129439664 GCTTGAAATAAGAAGCTGAATGG - Intergenic
1048117188 8:131537564-131537586 ACTTAAAAGGAGAAGCTGGGGGG - Intergenic
1049020537 8:139954619-139954641 ATTTGTAAGAAGAAGCTGCGAGG + Intronic
1049095041 8:140543814-140543836 ACAAGAAAACAGAAGCAGCACGG + Intronic
1049123606 8:140764719-140764741 ACTTGACAGCATAATCTGAACGG + Intronic
1050060643 9:1705955-1705977 ACTTGAAATGAGATGCTGGATGG + Intergenic
1050975559 9:11933423-11933445 ACTTGAAAGTAGAAGGTGGGAGG + Intergenic
1051349180 9:16183038-16183060 TCTTTAAAGCAGAAGCTGCAGGG - Intergenic
1051471039 9:17442479-17442501 ACTTGAACCCAGAAGGTGCAGGG - Intronic
1051698673 9:19795502-19795524 ACCAGAAAGCAGAAGTTTCAGGG - Intergenic
1052277718 9:26696495-26696517 AATTCAAAGCATAAGTTGCAAGG + Intergenic
1052617491 9:30860214-30860236 ACTTGAAAACAGATGATGCTAGG + Intergenic
1052683242 9:31721367-31721389 ACTTGAACCCAGAAGGTGGAGGG + Intergenic
1054268028 9:62939105-62939127 ACTAGAAAACAAAAGCAGCAGGG - Intergenic
1056194302 9:84214519-84214541 AAATGAAAGCAGAAGTTTCAAGG + Intergenic
1056514982 9:87341706-87341728 ACTGGGAAGCAGGAGCTGAAGGG - Intergenic
1059116496 9:111604402-111604424 ACTGGAAAGCTGAAAGTGCAGGG - Intergenic
1059585371 9:115600341-115600363 AATTTAAAGCAAAAGCTGCTAGG + Intergenic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061454483 9:130687511-130687533 ACATGAAAACAGAGGCAGCAGGG - Intergenic
1061817023 9:133203700-133203722 GCTTGGAAGGGGAAGCTGCATGG + Intergenic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062416536 9:136454066-136454088 TCTCGAGAGCAGAAGCAGCATGG - Intronic
1185550925 X:981800-981822 TCTTGGAACCAGAGGCTGCATGG - Intergenic
1185955833 X:4487960-4487982 ACCTTAAAGCAGGAGCTGAAGGG + Intergenic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1186750510 X:12616809-12616831 GCTTGATGGCAGAAGTTGCATGG + Intronic
1187805179 X:23111704-23111726 AACTCAAAGCAGAAGCTACATGG - Intergenic
1189028011 X:37418850-37418872 ACTAGAAAGCAAAAGGGGCAGGG - Intronic
1189566084 X:42242594-42242616 CCCTGAAAGCAGAGCCTGCAAGG + Intergenic
1190132169 X:47758560-47758582 AGATGAGAACAGAAGCTGCAAGG + Intergenic
1190972731 X:55367503-55367525 ACATGAAAGTAGAAGCAGCATGG + Intergenic
1191127608 X:56974463-56974485 ACTTGCAGCCAGAGGCTGCATGG - Intergenic
1191955187 X:66636393-66636415 ACCTGGGAGCAGAAGATGCAGGG + Intronic
1192702958 X:73495859-73495881 AATGGAAAGCAGAAGAAGCAGGG - Intergenic
1193255557 X:79344420-79344442 TCTTGAAAGCAGAAGATACTTGG - Intergenic
1193984941 X:88228911-88228933 GCTTGAAAGATCAAGCTGCAAGG - Intergenic
1194011856 X:88571402-88571424 ACTTGAAAAGTGAAGATGCATGG + Intergenic
1194183940 X:90748297-90748319 TCTTGAAAGCAGAAGATACTTGG + Intergenic
1195759257 X:108228322-108228344 CCTTGAAAACAGATGATGCATGG + Intronic
1195889735 X:109679263-109679285 TCTTGAAAGTGGAAGCTCCAGGG - Intronic
1198561929 X:137859718-137859740 ACTTGAAAGGAGAATTTGCATGG + Intergenic
1199126981 X:144134212-144134234 ACCTGAAGGCAGAAACTGAAAGG + Intergenic
1199579405 X:149346264-149346286 TGTTGAAAACAGAAGCTGCCGGG - Intergenic
1200158345 X:153990384-153990406 AGTTGAAAGCAGGAGCTTGAAGG + Intergenic
1200244761 X:154517003-154517025 ACTTGAAAGCTGAACCTGAGAGG - Intergenic
1200408982 Y:2843145-2843167 ACTTGGAAGCAGAAACTGACAGG - Intronic
1200728721 Y:6706922-6706944 AATTGAAAGCAGGAGATGCCAGG - Intergenic
1200882031 Y:8224588-8224610 ACTTGAAATCGGAAGGTGTAGGG - Intergenic
1201710164 Y:16982549-16982571 ACTAGAAAGCAGAAGGAGAAAGG - Intergenic
1201733367 Y:17229982-17230004 ACTTGAAGCCAGAGACTGCATGG + Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic