ID: 1162871746

View in Genome Browser
Species Human (GRCh38)
Location 19:13591637-13591659
Sequence CCAGCTAGGGATCGGATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162871746_1162871761 26 Left 1162871746 19:13591637-13591659 CCACCCATCCGATCCCTAGCTGG 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1162871761 19:13591686-13591708 CCTGCAGTTTGGCTGAGCCTGGG No data
1162871746_1162871754 0 Left 1162871746 19:13591637-13591659 CCACCCATCCGATCCCTAGCTGG 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1162871754 19:13591660-13591682 GAAAGTCACCCAGTCCTAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 109
1162871746_1162871759 25 Left 1162871746 19:13591637-13591659 CCACCCATCCGATCCCTAGCTGG 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1162871759 19:13591685-13591707 ACCTGCAGTTTGGCTGAGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 231
1162871746_1162871758 15 Left 1162871746 19:13591637-13591659 CCACCCATCCGATCCCTAGCTGG 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1162871758 19:13591675-13591697 CTAGCTGGTGACCTGCAGTTTGG 0: 1
1: 0
2: 0
3: 17
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162871746 Original CRISPR CCAGCTAGGGATCGGATGGG TGG (reversed) Intronic
901656671 1:10773423-10773445 CCTGGGAGGGATTGGATGGGTGG + Intronic
902698056 1:18153702-18153724 CCAGCTAGGGATGGCAGAGGTGG + Intronic
904946298 1:34201047-34201069 CCAGGGAGGGATTGGAGGGGAGG + Intronic
914985644 1:152455026-152455048 TCAGCTAAGGATCTGAGGGGAGG + Intergenic
916226394 1:162493948-162493970 CCTGTTGGGGATGGGATGGGAGG + Intergenic
919999366 1:202785232-202785254 CCAGCTAGGGTTAGGCTGGAAGG - Intronic
920181620 1:204135269-204135291 GAAGCCAGGGATTGGATGGGAGG + Intronic
921054182 1:211531753-211531775 CCAGGGAGGGTTCCGATGGGAGG + Intergenic
1070332889 10:75430904-75430926 CCAGGTGGGGATGGGGTGGGTGG + Intergenic
1082786043 11:57317375-57317397 CCAGCCAGGGAAAGCATGGGAGG + Intronic
1089345919 11:117791658-117791680 CCAGCTAGGTGACGGATGGAAGG + Intronic
1089679979 11:120113925-120113947 CAAGCCAGGGAGGGGATGGGAGG - Intronic
1091456664 12:613115-613137 CCAGCCAGGGATGGCAGGGGAGG - Intronic
1091604060 12:1935492-1935514 CCAGCGTGGCATCCGATGGGTGG + Intergenic
1092084139 12:5741888-5741910 CCAGCTAGGGATCCCATGGCAGG - Intronic
1099018924 12:77379489-77379511 CCTGCTAGGGTGAGGATGGGGGG + Intergenic
1099740192 12:86624967-86624989 CCAGGGAGGGATCTGGTGGGAGG + Intronic
1100521938 12:95383465-95383487 CCATCTAGGGTTTGGATGGATGG + Intergenic
1101718149 12:107329073-107329095 CCAGCTAGGCAGGGTATGGGGGG - Intronic
1103358337 12:120338452-120338474 CCAGGGAGGGATCTGGTGGGAGG - Intergenic
1109675046 13:65664194-65664216 CCAGGGAGGGATCTGGTGGGAGG - Intergenic
1114577747 14:23729064-23729086 CCAGATAGTGATTGGATAGGAGG + Intergenic
1120529454 14:85614558-85614580 CCTGATAGGGAGCGGCTGGGTGG + Intronic
1122034448 14:98937175-98937197 CCAGCAAGGGAAAGGTTGGGAGG + Intergenic
1122861196 14:104583062-104583084 CCAGTTAGGGAGGGGATGGCAGG + Intronic
1136034654 16:27530044-27530066 CCAGCAAGGGAGCGAATGGCAGG + Intronic
1136413773 16:30091557-30091579 CCGGCTAGGGATAAGCTGGGGGG + Intronic
1138110180 16:54317607-54317629 CCAGCTGGGGAGCGGTTGGAGGG + Intergenic
1141804107 16:86331298-86331320 GCATCTAGGGACCTGATGGGAGG + Intergenic
1143016318 17:3892920-3892942 CCAGGTAGGGATCGGCGGGGCGG - Exonic
1144735664 17:17553955-17553977 CCAGCCAGGGGTGGGGTGGGGGG + Intronic
1146948775 17:36891609-36891631 CCAGCCAGGGAGAGGTTGGGAGG - Intergenic
1149249863 17:54755623-54755645 TCAGGTAGGGATGGGATGGGAGG + Intergenic
1152621303 17:81366189-81366211 CCAGCTGGGGGTGGGAAGGGAGG + Intergenic
1154202875 18:12311179-12311201 CCAGCTAGGGATGGGAGGGGTGG - Intronic
1160809882 19:1008779-1008801 CCAGGTGGGGAGCGGGTGGGCGG + Exonic
1162871746 19:13591637-13591659 CCAGCTAGGGATCGGATGGGTGG - Intronic
1163156508 19:15442675-15442697 CCAGCTGCTGATCCGATGGGTGG + Intronic
926155081 2:10448910-10448932 CCAGCTAGGGAGCAGAGGCGCGG + Intergenic
929055821 2:37875295-37875317 CCAGCTAGGGAACTGCAGGGCGG + Intergenic
930536260 2:52649431-52649453 CCAGGGAGGGATCTGGTGGGAGG - Intergenic
933392796 2:81693495-81693517 GCAGCTGGGGTTCGGTTGGGGGG - Intergenic
935351266 2:102153564-102153586 CCAGGGAGGGATCTGGTGGGAGG + Intronic
936380546 2:111981885-111981907 CCAGCTAGAGATCAGCTTGGTGG - Intronic
937442811 2:121931321-121931343 CCTGCTGTGGATCAGATGGGTGG + Intergenic
937671402 2:124541321-124541343 GCAGCCAGGGAAGGGATGGGAGG - Intronic
939627897 2:144501058-144501080 TCAGCTAGAAATTGGATGGGGGG + Intronic
940581445 2:155585012-155585034 CAAGCCAGGGAGCAGATGGGAGG - Intergenic
1170165300 20:13355759-13355781 ATAGCTAGGGATCTGATGGTGGG + Intergenic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174376446 20:50129514-50129536 CCAGCTAGTGGTGGGCTGGGAGG - Intronic
1175335589 20:58193817-58193839 CCAGGTAGAGATGGGAAGGGAGG - Intergenic
1177045171 21:16160149-16160171 CCAGCCAGGGATGTGGTGGGCGG + Intergenic
1179005571 21:37511151-37511173 GTAGCCAGGGATAGGATGGGTGG + Intronic
1179150056 21:38802189-38802211 CCTGCTAGGGAATGGCTGGGCGG + Intergenic
1181572267 22:23773968-23773990 GCAGAAAGGGATGGGATGGGTGG + Intronic
1184259774 22:43307997-43308019 CCTGCTTGGGATTGGGTGGGGGG - Intronic
949125815 3:444267-444289 CCAGCCAGGGATCCAATGTGGGG + Intergenic
955611080 3:60758037-60758059 CCAGCCAGAGATCAGAAGGGAGG + Intronic
958918156 3:100072598-100072620 CCAGCTGGGGATTGGAGGTGGGG - Intronic
966124545 3:176560985-176561007 CTAGGTAGGGATGGGATGGTGGG - Intergenic
968816172 4:2823088-2823110 CCAGCTGGGGCTCTGCTGGGAGG - Intronic
969685593 4:8672297-8672319 GCAGCTAGGGATGGGAGTGGGGG + Intergenic
972844287 4:42969675-42969697 CCAGGGAGGGACCTGATGGGAGG - Intronic
974924356 4:68278792-68278814 CCAGAGAGGGATCTGGTGGGAGG - Intergenic
984864926 4:184273245-184273267 ACAGATAGGGATGGGATGGTGGG - Intergenic
986529740 5:8723863-8723885 CCAGGGAGGGACCTGATGGGAGG + Intergenic
988107612 5:26771406-26771428 CCAGCTAGGGAGCCAATGTGGGG - Intergenic
988561983 5:32289759-32289781 CCAGTTAGGGAACGAATGTGGGG - Intronic
995286628 5:110396271-110396293 CCAGGTAGGAACCTGATGGGAGG - Intronic
1001208811 5:169790989-169791011 GCAGCTGGGGGTGGGATGGGAGG - Intronic
1005646172 6:27840383-27840405 ACAGCTAGGAATCGAATGGTTGG - Intronic
1006303713 6:33207231-33207253 CCGGCCTGGGGTCGGATGGGGGG + Intergenic
1018320847 6:162607049-162607071 CCAGCTTGGGAGTGGGTGGGTGG + Intronic
1028307930 7:89290060-89290082 CCAGTTAGGGACTGGAAGGGTGG - Intronic
1031419805 7:121537899-121537921 CCAGGTAGGGATGGGAAGAGAGG - Intergenic
1034276846 7:149827600-149827622 CCAGCTAGTGTTTGGGTGGGTGG + Intergenic
1034724803 7:153325367-153325389 CCAGCCTGGGATTGGAGGGGAGG + Intergenic
1034737390 7:153441535-153441557 CCAGAAAGGGATCTGAAGGGTGG - Intergenic
1038041573 8:23727863-23727885 CCAGCCTGGGAAGGGATGGGAGG + Intergenic
1039785562 8:40831646-40831668 CCAGTGAGGGATAGTATGGGTGG - Intronic
1040394113 8:46979016-46979038 CCAGCTAGGGAATTGATAGGGGG + Intergenic
1042225609 8:66512392-66512414 CCAGCTTGGGATGGGAGGAGGGG + Intronic
1053382039 9:37656865-37656887 CCAGCTTGGGAAAGGATTGGTGG - Intronic
1058752431 9:108052354-108052376 CCAAAGAGGGATGGGATGGGAGG + Intergenic
1060641161 9:125240632-125240654 CCAGTTAGAGAACGGGTGGGTGG - Intronic
1062238816 9:135525240-135525262 CCAGGTAGGAGTGGGATGGGTGG - Intronic
1192946218 X:75967549-75967571 CCAGCTCAGGAAGGGATGGGGGG + Intergenic
1200067832 X:153512997-153513019 CCAGCTGGGGCTTGGATGAGTGG + Intergenic
1200146228 X:153927759-153927781 CCAGTCAGGGCTCGGATGGAGGG - Intronic