ID: 1162873008

View in Genome Browser
Species Human (GRCh38)
Location 19:13600030-13600052
Sequence TCTCCCTCCAGCACAGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 318}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162872997_1162873008 26 Left 1162872997 19:13599981-13600003 CCAGGAAGACTTCAACATCCACG 0: 1
1: 0
2: 0
3: 12
4: 105
Right 1162873008 19:13600030-13600052 TCTCCCTCCAGCACAGTGAGGGG 0: 1
1: 0
2: 1
3: 23
4: 318
1162872996_1162873008 27 Left 1162872996 19:13599980-13600002 CCCAGGAAGACTTCAACATCCAC 0: 1
1: 0
2: 2
3: 14
4: 173
Right 1162873008 19:13600030-13600052 TCTCCCTCCAGCACAGTGAGGGG 0: 1
1: 0
2: 1
3: 23
4: 318
1162873003_1162873008 1 Left 1162873003 19:13600006-13600028 CCTCGCTCAGAAATCCCAGGGTC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1162873008 19:13600030-13600052 TCTCCCTCCAGCACAGTGAGGGG 0: 1
1: 0
2: 1
3: 23
4: 318
1162873000_1162873008 8 Left 1162873000 19:13599999-13600021 CCACGGGCCTCGCTCAGAAATCC 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1162873008 19:13600030-13600052 TCTCCCTCCAGCACAGTGAGGGG 0: 1
1: 0
2: 1
3: 23
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162873008 Original CRISPR TCTCCCTCCAGCACAGTGAG GGG Intronic
901068172 1:6504460-6504482 TCCCCCTCCTCCACAGTGGGGGG + Intronic
901070667 1:6515951-6515973 TCTCCCACCAGCAGAGTAAGTGG - Intronic
901080393 1:6580620-6580642 CCTTCGTCCAGCACAGTGTGAGG + Exonic
902301943 1:15508016-15508038 TCTCCCACCAGCAGAGTCTGAGG - Intronic
902665039 1:17931480-17931502 CTTCCCTCCAGCACTCTGAGTGG + Intergenic
902868340 1:19296033-19296055 TCTCTCTCCTGCAGAGAGAGGGG + Intergenic
903113724 1:21160825-21160847 TCTCCTTCCAGCACAGTACGAGG + Intronic
903215702 1:21842249-21842271 TCACCGTCCCGCCCAGTGAGGGG - Exonic
903995356 1:27302021-27302043 TCATTCTCCAGCACACTGAGGGG - Intronic
904318649 1:29682333-29682355 CCTCGCCCCAGCCCAGTGAGGGG - Intergenic
904575468 1:31502508-31502530 CCTTCCCCCAGCACAGTGTGTGG + Intergenic
904748260 1:32724752-32724774 TCTCCCTCCTCCCCACTGAGAGG - Intergenic
905825326 1:41022149-41022171 TCTGTCTCCAGCACAGAGAAGGG - Exonic
906214095 1:44029315-44029337 ACTTCCTCCAACACAGTGAATGG - Intronic
910926606 1:92404180-92404202 TCTCTCTTCAACTCAGTGAGAGG + Intergenic
911171509 1:94775116-94775138 TCTGCTTCCAGCTCAGTGTGAGG - Intergenic
915073770 1:153292960-153292982 GCTGCATCCACCACAGTGAGGGG + Intergenic
915403143 1:155638753-155638775 ACTCCTTCCAGCATAGTTAGGGG + Intergenic
916949258 1:169762265-169762287 TCTCACTTGAGAACAGTGAGAGG - Intronic
917297177 1:173532720-173532742 TCTGCCTCCAGAACAGTGCCTGG - Intronic
917797711 1:178543506-178543528 GCTCCCTCCAACACCGTCAGAGG - Intronic
918489092 1:185061089-185061111 TCTCACTCCAGCACCCAGAGTGG - Intronic
919822591 1:201482395-201482417 TCTGGCTCCAGCACAGGGGGTGG - Intergenic
920503988 1:206503776-206503798 TCTCCCTTTGGCACAGTGACTGG + Intergenic
921411735 1:214843186-214843208 TCTTTCTCCAGCTCATTGAGTGG + Intergenic
923276340 1:232400149-232400171 GCTCCTTACAGCAAAGTGAGTGG - Intronic
924546243 1:245030510-245030532 TGTCCTTCCAGTACACTGAGAGG - Intronic
1062984407 10:1754607-1754629 GCACCCTGCAGCACAGCGAGCGG - Intergenic
1063020231 10:2119676-2119698 TCTCTCTCCTGCAGAGAGAGAGG + Intergenic
1063459934 10:6208779-6208801 TCCCCCACCTGGACAGTGAGAGG - Intronic
1064215909 10:13400570-13400592 TCTCTCTCCTGCAGAGAGAGAGG + Intergenic
1065068921 10:22002895-22002917 TCTTCCTCCAGCACAGCTGGAGG + Intronic
1067284358 10:44896654-44896676 TCTTCCACCAGCTCAGTGATTGG + Intergenic
1067924215 10:50491447-50491469 TCTTCATCCAGCAAAGTGAATGG + Intronic
1068507067 10:57914665-57914687 TCTCTCTCCTGCAGAGAGAGAGG + Intergenic
1070660263 10:78300624-78300646 TCTCCCTCCAACACAGCAAGAGG - Intergenic
1070704076 10:78624885-78624907 AGTCCCTCTAGCAAAGTGAGGGG + Intergenic
1071400484 10:85264031-85264053 TCTCCCTCCACTACATAGAGAGG + Intergenic
1071471017 10:85984119-85984141 TCTCCCTGCACCACAGAGAGAGG + Intronic
1071949991 10:90692595-90692617 TCTCTCTCCTGCAGAGAGAGGGG + Intergenic
1072790843 10:98316663-98316685 CCTCACTGCAGCTCAGTGAGTGG - Intergenic
1074413297 10:113246101-113246123 TCTCCTTCCAAGGCAGTGAGTGG - Intergenic
1074563144 10:114552172-114552194 ACTCTCTCCAGCACAGTGTCAGG - Intronic
1075330902 10:121573433-121573455 TCTCCCTCCTCCAAAGTCAGAGG + Intronic
1078404153 11:11054642-11054664 TCTCCCTCCTGCAGTGTCAGTGG - Intergenic
1080449254 11:32365169-32365191 TCTCCCTTCTGCAGAGAGAGAGG + Intergenic
1081803968 11:45879791-45879813 CCAGCCTCCAGAACAGTGAGAGG - Intronic
1081874594 11:46399976-46399998 TCTCTCTCCAGCACCGTGCAAGG - Intronic
1082735716 11:56853532-56853554 TCTGGCTCCTGGACAGTGAGTGG - Intergenic
1083163687 11:60870899-60870921 TGTCCATCCAGCACAGAGACGGG - Intronic
1084474768 11:69382496-69382518 TCTCCCGCCAGCAGAGGGACCGG + Intergenic
1084675346 11:70630789-70630811 TCTGCCTCCAGAACTGTGAGGGG + Intronic
1085307695 11:75497471-75497493 CCTGCCTCCTGGACAGTGAGGGG + Intronic
1086294245 11:85347264-85347286 TCCCCCTGAAGCACAGGGAGGGG + Intronic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1090158768 11:124469413-124469435 TCTCCATTCAGCACTCTGAGGGG + Intergenic
1090532183 11:127602049-127602071 CCTCCCTCCAGGACAATGTGAGG - Intergenic
1090763332 11:129855912-129855934 TCTCCATCCAGACCAGCGAGGGG - Intronic
1090883076 11:130851665-130851687 TCTCCTCCCAGCACAGAGAGTGG - Intergenic
1090930509 11:131293965-131293987 TCTCACTCCATCCCTGTGAGAGG - Intergenic
1091172401 11:133530427-133530449 CTTTGCTCCAGCACAGTGAGAGG + Intronic
1091285475 11:134406178-134406200 TCGCCCTCCAGACCAGGGAGGGG + Intronic
1102235722 12:111293435-111293457 TCTCCCTGCAGAGCAGAGAGAGG + Exonic
1103921307 12:124400669-124400691 TCTCCCTACAGGCCAGAGAGGGG + Exonic
1104652277 12:130544212-130544234 TCCCCTTCCAGGACATTGAGAGG - Intronic
1105787410 13:23762954-23762976 GGTCCCTCCAGCATAGTGAAGGG + Intronic
1106081475 13:26504034-26504056 CCTCACTGCAGCAGAGTGAGAGG - Intergenic
1106801014 13:33255735-33255757 ACTCCCTCCAGGGCAGGGAGGGG + Intronic
1106809911 13:33349844-33349866 TCTCCCTCCCGCGCATTCAGTGG + Intronic
1109236795 13:59831581-59831603 TCTATCTCCAGCTCAGTAAGAGG + Intronic
1109261823 13:60154074-60154096 TCTGCCTCCAGCACACCAAGAGG + Intronic
1109550408 13:63890329-63890351 TCTCCCTCCTACAATGTGAGAGG - Intergenic
1109813760 13:67551388-67551410 TCTCTTCCCAGCACAGTGATTGG - Intergenic
1110187771 13:72694630-72694652 TCTGCCCCCAGCACACCGAGTGG - Intergenic
1110908371 13:80921780-80921802 TCTGCCTCCAGCAAAGTAACAGG + Intergenic
1112374710 13:98828212-98828234 TCTGCCTCCAGAACTGTGAGAGG + Intronic
1113061747 13:106329967-106329989 TCTTCCTCCATCACACTGAGTGG - Intergenic
1117976391 14:61301064-61301086 TCTCTCTCCTGCAGAGAGAGCGG - Intronic
1118978819 14:70699897-70699919 TCACCCTGCAGCCCAGTGACAGG + Intergenic
1119739980 14:77008033-77008055 GCTCCCTCCCCCACAGTGGGAGG + Intergenic
1120849378 14:89155596-89155618 TACTCCTCCAGCACGGTGAGTGG + Intronic
1121220842 14:92284333-92284355 TTGCCATCCAGCACAGTGACTGG - Intergenic
1121521903 14:94591876-94591898 TCACCCCCCAGCACAGTGCCTGG + Intronic
1122203510 14:100136805-100136827 TCTTCCAACAGCCCAGTGAGTGG + Intronic
1122556028 14:102580551-102580573 GAGCCCTCCAGCACAGGGAGCGG + Intergenic
1122717993 14:103706835-103706857 GCTCCTTCCAGAACAGGGAGGGG - Intronic
1122760721 14:104023476-104023498 TTTCCCTCCCGCCCAGAGAGTGG + Intronic
1123705435 15:22947641-22947663 TGCCCCTCCAGCACTTTGAGGGG - Intronic
1123768632 15:23507150-23507172 ACTCCTTCCAGCATAGTTAGGGG + Intergenic
1124189614 15:27563438-27563460 TCACCCTCCAGGCCAGAGAGGGG + Intergenic
1125178444 15:36852815-36852837 TCTTCCTCCAGGAGAGTAAGAGG + Intergenic
1125678356 15:41514355-41514377 TTTCACCCCATCACAGTGAGAGG - Intergenic
1125731227 15:41893770-41893792 GGTCCCTCCACCACAGTGACTGG + Intronic
1126072669 15:44879280-44879302 TCTGCCTCCAGCATAGCTAGGGG + Intergenic
1126885987 15:53150559-53150581 TCTCTCTCCTGCAGAGAGAGAGG - Intergenic
1127355974 15:58200573-58200595 TCCATCTCCAGCACTGTGAGAGG + Intronic
1127859151 15:62978689-62978711 TCTCCCTTCAGGGCAGTCAGTGG - Intergenic
1128061520 15:64738609-64738631 TTTCCCACCAGCACAGGCAGGGG + Intergenic
1128941411 15:71790682-71790704 TGTACCTCCAGGACAGGGAGTGG - Intergenic
1129228090 15:74181402-74181424 GCACCCACCAGCACATTGAGGGG + Exonic
1129274248 15:74434660-74434682 CCTCCCTCCCCCACAGTGAGTGG - Intergenic
1129708226 15:77806737-77806759 TCTCCCCACAGCACAGGCAGAGG + Intronic
1132522883 16:399538-399560 TTTCCCCCCAGCAAAGGGAGGGG + Intronic
1132573254 16:653242-653264 TCCCACTCCAGCCCAGGGAGAGG - Intronic
1133737534 16:8627352-8627374 TGTCCCTCAAACACAGGGAGGGG + Intronic
1134061383 16:11201659-11201681 TCTTCCTCCAGGGCACTGAGAGG + Intergenic
1135092008 16:19524461-19524483 TCCCTCTCCAGCACCGTGGGAGG - Intronic
1136084168 16:27872752-27872774 ACTCCCACCAGCACCATGAGAGG + Intronic
1138355326 16:56373190-56373212 CCTGCTTCCAGCACAGGGAGGGG + Intronic
1138922135 16:61544247-61544269 TCTACCTGCTGCAGAGTGAGGGG - Intergenic
1139514940 16:67447292-67447314 TTTCTCTCCTGCCCAGTGAGGGG + Intronic
1139700939 16:68707628-68707650 TCTCCTTTCAGCCCACTGAGAGG - Intronic
1139737177 16:69001183-69001205 ACTCTTTCCAGCACAGTTAGGGG + Intronic
1140065568 16:71608382-71608404 TTTCCCTTCACCACATTGAGAGG + Intergenic
1141619958 16:85232040-85232062 GCTCACTCCCCCACAGTGAGAGG + Intergenic
1141860282 16:86711625-86711647 TCTCCCTCCAGAACTCTGTGTGG + Intergenic
1142847907 17:2691001-2691023 CCTCCCTCCAGCGCAGGGGGAGG + Intronic
1144590250 17:16517633-16517655 TGTGGCCCCAGCACAGTGAGTGG - Intergenic
1144909808 17:18671962-18671984 TCTAACGCCAGCACAGTCAGTGG - Intronic
1145932838 17:28698274-28698296 TCTCCCTCCCACAGAGTGACAGG + Intronic
1147548205 17:41419517-41419539 TACCCCTCAACCACAGTGAGAGG + Intergenic
1147650549 17:42059347-42059369 TCTCCCTCCAGCCCTGTGCTGGG - Intronic
1148006311 17:44433365-44433387 CCTGCATCCAGCACAGTGTGTGG - Intronic
1148136295 17:45294025-45294047 TCTCCCTCCTGCAGCGTGTGGGG + Intronic
1148647514 17:49227659-49227681 TCTCCCTCCTGAATAGTCAGGGG - Intronic
1149629449 17:58110223-58110245 TCTTCCTCCAGAACAGGCAGAGG - Intergenic
1149681751 17:58512481-58512503 TCACCCTGCAGCACTGTGAAGGG + Exonic
1150823306 17:68453347-68453369 TCTACCTCCAACACAACGAGGGG + Intronic
1151658808 17:75508063-75508085 CCTCCCTCCAGCCCAGGGACAGG + Intronic
1152471437 17:80492046-80492068 TCTCCCTCCAGCACCAGGAGAGG - Intergenic
1152474899 17:80511859-80511881 GCTCCCACCAGCCCAGGGAGAGG - Intergenic
1152704431 17:81835382-81835404 TCTACCTCCTGGAAAGTGAGGGG + Intergenic
1152937958 17:83151712-83151734 GCTCCCTGCAGCTCAGTGTGAGG + Intergenic
1152939377 17:83159844-83159866 TCTGGCCCCAGCACAGGGAGAGG - Intergenic
1153591828 18:6682652-6682674 TCTCCCTCCATTACAGGGAAAGG - Intergenic
1154466075 18:14643405-14643427 TGTCTCTGCAACACAGTGAGAGG - Intergenic
1156338506 18:36189703-36189725 TCTCTTTCCAGCATGGTGAGTGG - Intronic
1157070404 18:44400787-44400809 TTTCCCCCCTGAACAGTGAGAGG - Intergenic
1157918750 18:51695108-51695130 TCTCTCTCCTGCAGAGAGAGAGG + Intergenic
1159898412 18:74019340-74019362 TCTCCCTCCTGCACAGACTGAGG - Intergenic
1160784896 19:895619-895641 TCTACCTCCAGCATTGTGAGAGG + Intergenic
1160825979 19:1080795-1080817 TCTCTCTCCAGCCCCGTCAGGGG - Intronic
1161090722 19:2358717-2358739 TCTCCCTCCAGCACCAGGCGTGG + Intergenic
1161583688 19:5093967-5093989 TCTGCCTCCAGAACTGAGAGAGG - Intronic
1161873082 19:6885671-6885693 TCTCTCTCCTGCAAAGAGAGGGG - Intergenic
1162038639 19:7956062-7956084 TCTCCCTGCTGCCCAGTGGGTGG + Intergenic
1162050356 19:8028968-8028990 ACCTCTTCCAGCACAGTGAGGGG + Intronic
1162507723 19:11096676-11096698 TCTCCCTCCAGCTGCTTGAGTGG + Intronic
1162769532 19:12940730-12940752 TCTCCCTTCTGCAGGGTGAGTGG + Exonic
1162873008 19:13600030-13600052 TCTCCCTCCAGCACAGTGAGGGG + Intronic
1162880192 19:13653148-13653170 TCTCTCTCCTGCAGAGAGAGAGG - Intergenic
1164460606 19:28444347-28444369 TCTCCCTCCAGCTAACTGAGGGG + Intergenic
1164575913 19:29405151-29405173 TCTCCCTCGAGCGCTGGGAGGGG + Intergenic
1165144798 19:33724304-33724326 TTCCCCTTCTGCACAGTGAGAGG - Intronic
1165446625 19:35860326-35860348 TCTCCCTCCTGCACAGTGTGTGG - Exonic
1166247705 19:41541622-41541644 TCTCTTTCCAGCACAGAGAGGGG + Intergenic
1166342070 19:42144111-42144133 GCTCCATCCAGCCCAGTGATGGG - Intronic
1166569436 19:43784560-43784582 GCTGCCTCCAGCCCAGGGAGGGG + Intergenic
1166645936 19:44531734-44531756 TCTCACTGCAGCCCTGTGAGGGG + Intergenic
1167712772 19:51122732-51122754 TCTCCCTCCAGGACAGGCAGTGG - Intergenic
1168426005 19:56239512-56239534 ACTCACTCCAGGACGGTGAGAGG - Intronic
925331545 2:3062657-3062679 CCTCCCTGCAGCACACTCAGGGG + Intergenic
926120071 2:10237034-10237056 TCTCCCACCAGCAGAGGGAAAGG + Intergenic
927936862 2:27080928-27080950 TCTCCCCCCAGTCCACTGAGGGG - Exonic
928216665 2:29367162-29367184 TCACCCTCCAGCACAGAGCCTGG - Intronic
928538333 2:32261251-32261273 TCTCTCTCCTGCAGAGAGAGAGG - Intronic
929239172 2:39636044-39636066 TTTCCCTCCAGCAGTGTTAGAGG - Intergenic
932076111 2:68664406-68664428 TGTGCTTCCATCACAGTGAGGGG + Intergenic
932585283 2:73023874-73023896 TCTCTTTCCAGCACAGAGACAGG + Intronic
932770195 2:74496857-74496879 TCACCCTCCTGCAGTGTGAGGGG - Intergenic
936256801 2:110923035-110923057 TCTCCCTACATCACAGTAGGGGG + Intronic
937536405 2:122894284-122894306 TCACCTCCTAGCACAGTGAGTGG + Intergenic
938214464 2:129499179-129499201 TAGCCCTCCAGTACAGTGTGAGG - Intergenic
944601497 2:201308166-201308188 TCACCATCCAGCTCAGTCAGAGG - Intronic
945220051 2:207474268-207474290 CCTCACAACAGCACAGTGAGAGG + Intergenic
946419432 2:219556666-219556688 TCGCCCTCGTGGACAGTGAGTGG + Exonic
948175683 2:235940787-235940809 TCTAACTCCACCACAGAGAGGGG + Intronic
948643057 2:239387503-239387525 TCTCCCTCCAGCCTAGAGACAGG + Intronic
1169242079 20:3991080-3991102 TCTCCTTCCAGCCCTGTCAGAGG - Intronic
1170910866 20:20566392-20566414 TCTGTCTACAGCACAGGGAGTGG + Intronic
1171367549 20:24636378-24636400 TCTCTCTCCTGCAGAGAGAGAGG + Intronic
1172105883 20:32517149-32517171 TCTCTCCCCAGCAGAGTGGGGGG - Intronic
1173225205 20:41158487-41158509 ACACTCTCCAGCACAGGGAGGGG - Intronic
1173751977 20:45484181-45484203 TATCCTTCCATCATAGTGAGGGG + Intergenic
1173820256 20:46014777-46014799 TCTCCCTGTAGCACAGTGCCTGG - Intronic
1174054150 20:47786291-47786313 GCTCCCTCCAGCTCCGAGAGAGG - Exonic
1174981001 20:55394698-55394720 TCTGCATCCAGCACAGTGCCTGG - Intergenic
1176012186 20:62903927-62903949 CCTGCCTCCTGCACTGTGAGCGG - Intronic
1176103533 20:63375312-63375334 TCTGGCTCCAGGACAGTGATGGG + Intronic
1176808510 21:13515191-13515213 TGTCTCTGCAACACAGTGAGAGG + Intergenic
1177125749 21:17191572-17191594 ACTGCCTGCAGCACAGTGAATGG - Intergenic
1178271515 21:31194095-31194117 TCTCTCTCCTGCAGAGAGAGAGG - Intronic
1179720126 21:43311552-43311574 TCTGGCCCCAGCACTGTGAGAGG - Intergenic
1180121243 21:45749862-45749884 TTTCCCTCCAGCACAGGATGTGG + Intronic
1181913310 22:26257768-26257790 ACTCCCTCCAGATCGGTGAGCGG - Intronic
1183154885 22:36067069-36067091 TCACCGCCCAGCACAGTGCGGGG - Intergenic
1184238690 22:43200257-43200279 TCTCCCTGGAGCACAGCGTGCGG + Exonic
1184458330 22:44623939-44623961 CCTCCCCCCAGCACACAGAGAGG - Intergenic
1185080908 22:48708830-48708852 TTTCCCTGCAGCCCAGTGTGAGG - Intronic
949374891 3:3378183-3378205 TCGCCCTCCAGCACAATGCCTGG - Intergenic
949586507 3:5444647-5444669 TCCCCCTCCAAAAAAGTGAGGGG - Intergenic
949609125 3:5686132-5686154 TCTCTCTCCTGCAGAGAGAGAGG + Intergenic
950401939 3:12775589-12775611 TCTCCCACCCCTACAGTGAGGGG - Intergenic
950850755 3:16060162-16060184 TCTTTCTTCAGCACAGTGATGGG + Intergenic
951184917 3:19702510-19702532 GCTTCCGCCAGCCCAGTGAGGGG - Intergenic
952332157 3:32374017-32374039 TCCTCCTCCACCACAGTGATTGG + Intergenic
952825055 3:37517740-37517762 TCTCCCCACAGCACATTGATGGG - Intronic
952835201 3:37596445-37596467 TCTTCCTCCAGCCCAGAGAAAGG + Intronic
953473589 3:43186917-43186939 TGGCCCTCCAGAACAGGGAGGGG - Intergenic
953850756 3:46464089-46464111 GCTCCCTGCAGCACCGGGAGGGG - Intronic
954130970 3:48560818-48560840 TCTTCCTCCAGCCCAGGGGGAGG - Intronic
954304936 3:49720639-49720661 TCTCCCTGCAGAGCTGTGAGTGG + Exonic
955396320 3:58560255-58560277 TCTCCCTCTCGCCCAGTGTGAGG + Intergenic
956019924 3:64923407-64923429 TCTCCCTCCAGCAAGAAGAGGGG - Intergenic
956022809 3:64950226-64950248 TCTCCCTCCAGCTTCATGAGTGG + Intergenic
956561074 3:70575321-70575343 TATCCCTCCAGGCCACTGAGAGG + Intergenic
956722125 3:72127457-72127479 GCTCAGTCCAGCAGAGTGAGAGG + Intergenic
958813753 3:98893044-98893066 TCCACCCCCAGCTCAGTGAGAGG - Intronic
961096417 3:124160307-124160329 TCTCCCTCCTGCACATTGCAGGG - Intronic
961392902 3:126566734-126566756 ATTCCCTCCAGCAATGTGAGAGG - Intergenic
962965090 3:140346011-140346033 TCTCCATCCAGAGAAGTGAGTGG + Intronic
964013301 3:151916902-151916924 CCTCACTCAAGCCCAGTGAGAGG + Intergenic
964366111 3:155952420-155952442 TCTCCCTCCTGCAGAGAGGGGGG + Intergenic
965446772 3:168782562-168782584 TCTCTCTCCTGCAGAGAGAGAGG - Intergenic
967354604 3:188554231-188554253 TCTCCATGCACCACAGTGGGTGG - Intronic
967817647 3:193812903-193812925 CCTTCCCCCAGCACAGTCAGAGG - Intergenic
968132909 3:196202481-196202503 TCAACCCCCAGCACAGTGACTGG - Intronic
968288622 3:197522497-197522519 TCTTCCTCCTGCACAGTAGGAGG - Intronic
969460674 4:7327186-7327208 TCTGCCTCCAGAACAGGAAGAGG - Intronic
969574157 4:8026735-8026757 GCAGCCTCCAGCACTGTGAGAGG - Intronic
969593059 4:8132793-8132815 TCTCCCTGCAGCCCAGTCCGTGG - Intronic
975582742 4:75921484-75921506 TCCCCCACCAGCACAGTGCCTGG - Intronic
976218787 4:82739489-82739511 CCTCCCTCCAGGGCAGTGCGGGG - Intronic
976464176 4:85348755-85348777 TTTCACTCCAGAACAGTGAAAGG + Intergenic
977118604 4:93067351-93067373 TCAGCCTCCAGAACTGTGAGAGG - Intronic
977386248 4:96343195-96343217 TCTCCCTGGAGCAGAGTGGGAGG - Intergenic
981633114 4:146844635-146844657 TCTAATTCCAGCACTGTGAGAGG - Intronic
981753092 4:148112102-148112124 TCCCCCACCAGCACAGTGCTTGG - Intronic
982164707 4:152604186-152604208 TCAGCCTCCAGAACTGTGAGAGG + Intergenic
982602775 4:157472386-157472408 ACTCCTTCTAGCACAGTTAGGGG - Intergenic
982699397 4:158642861-158642883 TCTCTCTCCTGCAGAGAGAGAGG + Intronic
982782602 4:159506913-159506935 TCTTCCTCCGGCAAAGTAAGAGG - Intergenic
983699622 4:170576155-170576177 CCTCCCTCCACCACACTGAGAGG - Intergenic
984451684 4:179911343-179911365 TCTCCCATCAGCAGAGTCAGAGG - Intergenic
984727647 4:183036771-183036793 TCTCCCCTAAGCACAGGGAGGGG + Intergenic
985838216 5:2286038-2286060 CTTCTCTGCAGCACAGTGAGAGG + Intergenic
988133508 5:27137482-27137504 GCTCCCTCCAACACAATGTGTGG - Intergenic
989027083 5:37080288-37080310 CCTGACTCTAGCACAGTGAGTGG + Intergenic
989103485 5:37840226-37840248 TCTCCCTGCAGCCCAGGGAGGGG - Intergenic
990438962 5:55824668-55824690 TCTCTCTCCTGCAGAGAGAGAGG + Intergenic
990883400 5:60565252-60565274 TCTAACCCCAGCACATTGAGAGG + Intergenic
991936482 5:71806909-71806931 TATCCCTCCAGGACAGGGTGAGG - Intergenic
992422490 5:76620456-76620478 TCTCCCTCCAACTCAGTTAATGG - Intronic
993858081 5:93100009-93100031 TTTCCCTCCAGCTCTGTGGGAGG + Intergenic
994669746 5:102752175-102752197 TCGCCCGCCAGGGCAGTGAGGGG + Intergenic
995582626 5:113617424-113617446 TCGCCGGCCTGCACAGTGAGGGG + Intergenic
997388587 5:133495306-133495328 TCTCCAGCAATCACAGTGAGTGG - Intronic
997595299 5:135103302-135103324 TCTCCCTGCAGATCTGTGAGGGG + Intronic
997622411 5:135307510-135307532 TCTCCCTCCAGCAGCCTGGGAGG + Intronic
998739735 5:145187026-145187048 TGTCTCTCCAGCACAGTGTCTGG + Intergenic
999370355 5:151051515-151051537 TTTCCCCTCTGCACAGTGAGAGG + Intronic
999393118 5:151208674-151208696 TCTTCCTCCAGCCCAGGGTGGGG - Intronic
999546335 5:152632658-152632680 TTTCCATCCAGCATAGGGAGGGG + Intergenic
1001207968 5:169781781-169781803 TCTCCCGCCCCCACAGAGAGGGG + Intronic
1001516709 5:172360454-172360476 CCTCCCTCCAGCAGTGTGTGAGG - Intronic
1001949377 5:175805658-175805680 TTTCCTTCCAGCACAGTCAGAGG + Intronic
1002022045 5:176369697-176369719 TCTACCTCCAACACTTTGAGAGG + Intronic
1002449913 5:179312844-179312866 TCAGCCTCCAGAACCGTGAGAGG + Intronic
1002518098 5:179774246-179774268 TCTCCCAGCAGCACAATAAGGGG + Exonic
1003509996 6:6771631-6771653 TCTCCACCCAGCACAGGCAGAGG + Intergenic
1003925062 6:10870089-10870111 TCTCTCTCCTGCAGAGAGAGAGG + Intronic
1004539688 6:16538163-16538185 TCACCACCCAGGACAGTGAGAGG + Intronic
1005953833 6:30649740-30649762 TCTCCCTCCAGGAAAGGGGGAGG + Exonic
1006338128 6:33431630-33431652 TCCCCCTCCAGTCCAGGGAGGGG + Intronic
1007498090 6:42275521-42275543 TGTCCCTACATCACAGTGACTGG - Intronic
1010052747 6:71527025-71527047 CCTCCCTCCATCATACTGAGGGG + Intergenic
1011014876 6:82743699-82743721 TCTCCCTCCTCCACAGTGTCTGG - Intergenic
1013274757 6:108573455-108573477 CCTCCCACCAGCACACAGAGAGG - Intronic
1013283857 6:108663776-108663798 TCTAACGCCAGCACAGTCAGTGG + Exonic
1013418997 6:109949387-109949409 CCTCCCTGCAGAACAGTCAGAGG + Intergenic
1013661903 6:112306618-112306640 TCTGTGCCCAGCACAGTGAGGGG - Intergenic
1018246397 6:161828600-161828622 TCTCAACACAGCACAGTGAGAGG - Intronic
1019337749 7:493333-493355 TCTCATTCCAGCACCTTGAGGGG + Intergenic
1019969827 7:4531582-4531604 TCTCTCTCCTGCAGAGAGAGAGG - Intergenic
1021285238 7:18772620-18772642 TTTCCCTCCAGCACAATAAAAGG + Intronic
1022024973 7:26439677-26439699 GCTCTCTCCAGCATAGTGAGAGG - Intergenic
1022511481 7:30937473-30937495 TCTCTATCCAGCCCTGTGAGGGG - Intergenic
1023206748 7:37759031-37759053 TCTTCTTTCAGAACAGTGAGTGG - Intronic
1025003930 7:55341028-55341050 TCTCCCTGCTGCAGAGAGAGAGG + Intergenic
1027558254 7:79693555-79693577 TTTCCCACCAGAACAGTGCGTGG + Intergenic
1029340951 7:99944258-99944280 TCTCTCTCCTGCAGAGAGAGAGG + Intergenic
1030090811 7:105856852-105856874 TCTCCCTCCAGCACCCTGAATGG + Intronic
1031403006 7:121347445-121347467 CCTTCCTCCAGGCCAGTGAGGGG - Intergenic
1032838163 7:135692727-135692749 CCTCCCACCAGCACAGTGTTTGG - Intronic
1032842216 7:135723281-135723303 TGTCCAGCCAGCAAAGTGAGTGG - Intronic
1033121319 7:138669090-138669112 TCGCCCTCAAGCACAGGGAAGGG + Intronic
1037933514 8:22898853-22898875 TCTCCCTCCTGGGCAGTAAGGGG - Intronic
1038426395 8:27466982-27467004 TGTCCCTCTAGCACAGTGCCAGG + Intronic
1039565520 8:38549431-38549453 TCTTCCTCCAGCAGAGGCAGTGG - Intergenic
1040535569 8:48306489-48306511 TCTCCCTCCAAGACAAAGAGTGG + Intergenic
1041722410 8:60988109-60988131 TCTGCATCCATCTCAGTGAGGGG - Intergenic
1041939024 8:63366471-63366493 GCTCCCTACTGCACACTGAGTGG + Intergenic
1042627642 8:70776597-70776619 ACTCCCTCCAGATCAGTGAGTGG + Intronic
1042757830 8:72236992-72237014 TCTCCATGCAGCAAAGTGAAGGG + Intergenic
1042949089 8:74182515-74182537 TCTCCCTCCTGCAGAAAGAGAGG + Intergenic
1044172825 8:89077115-89077137 TCAGCCTCCAGAACTGTGAGAGG + Intergenic
1044591597 8:93917745-93917767 TCTCGCTCCAGCCCGGTGAATGG - Intronic
1044596818 8:93967741-93967763 TCTCCCAACAGCACACTGATGGG + Intergenic
1044615412 8:94135568-94135590 TCTCCCAACAGCACACTGATGGG + Intronic
1044639014 8:94359034-94359056 GCGCTCTCCAGCACAGTTAGTGG + Intergenic
1044733681 8:95255248-95255270 TCTCTCTCCAGCCCAGTCAGTGG + Intronic
1045876170 8:106983413-106983435 GCTCCCTCCACCACAGTAAAGGG + Intergenic
1048316276 8:133364853-133364875 TCTCTCTCCTGCAGAGAGAGAGG - Intergenic
1050196414 9:3088492-3088514 TCTCTCTCCTGCAGAGGGAGAGG - Intergenic
1052954829 9:34245633-34245655 TCTGCCTCCTGCACAGGGTGGGG + Intronic
1052958455 9:34273545-34273567 TCTGCCTCCTGCACAGGGTGGGG - Intronic
1053277864 9:36797001-36797023 TCTCCCTCTGTCACAGTGACTGG - Intergenic
1055468588 9:76589916-76589938 TCCCCCTCCAAAACAGTGAAGGG - Intergenic
1055567813 9:77586594-77586616 TCTCTCTCCTGCACACAGAGGGG + Intronic
1056673049 9:88647934-88647956 TCACCCACCTCCACAGTGAGGGG - Intergenic
1056764427 9:89436222-89436244 TCTCACTCAACCCCAGTGAGGGG + Intronic
1057053223 9:91941631-91941653 TTTCCCTCCAGCACAGGGTCAGG + Intronic
1057460539 9:95256764-95256786 TCTCCTTACAGCACACTGATGGG - Intronic
1058247106 9:102640892-102640914 ACTCCCTCCTGCAGAGAGAGGGG - Intergenic
1059441790 9:114311699-114311721 CCTCCCTCCAGGACCGTGAAGGG - Exonic
1060113797 9:120925755-120925777 TCTCCTTCCACCACAGCCAGAGG + Intronic
1060848259 9:126854467-126854489 TCTCCCTCCTCCACAGTGCTTGG + Intergenic
1061023936 9:128035214-128035236 TCTTCCTCCACCCCAGGGAGAGG - Intergenic
1061184231 9:129042675-129042697 TCACCCTCCAGTACAGTGACTGG - Intronic
1062408378 9:136408946-136408968 TCTCCATCCAACACAGTGCCAGG - Intronic
1062435476 9:136545014-136545036 TCTCCCCGCCGCACAGCGAGCGG - Intronic
1062509612 9:136897655-136897677 TTTCCCTCCAGCCCCGAGAGCGG - Intronic
1185506852 X:638268-638290 TCTCCCTTCAACACGGCGAGAGG - Intronic
1187434906 X:19258887-19258909 ACTGACTCCAGCCCAGTGAGTGG - Intergenic
1188103607 X:26121313-26121335 CCTCCCTCCAGCACAGGGATGGG + Intergenic
1189305386 X:39983149-39983171 TCCCCCAACAGCACAGTGACTGG + Intergenic
1190094509 X:47467742-47467764 GCAGCATCCAGCACAGTGAGCGG - Exonic
1190431839 X:50385559-50385581 TCTCCCTTCTGCACAGTGGAAGG - Intronic
1196175111 X:112631558-112631580 TCCACCTCCAGCACAGTAATAGG + Exonic
1198858719 X:141046316-141046338 TCTGCATACAGCACAGTGATGGG - Intergenic
1198903974 X:141541072-141541094 TCTGCATACAGCACAGTGATGGG + Intergenic
1199195879 X:145029916-145029938 TCTGTGTCCAGCACAGTGAATGG - Intergenic
1199937860 X:152594628-152594650 ACTCACTCCACCACAGTGACGGG - Intergenic