ID: 1162873074

View in Genome Browser
Species Human (GRCh38)
Location 19:13600342-13600364
Sequence GGCCACAGAGGGCGGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162873066_1162873074 -10 Left 1162873066 19:13600329-13600351 CCTCCCAGGTGCCGGCCACAGAG No data
Right 1162873074 19:13600342-13600364 GGCCACAGAGGGCGGGATGCTGG No data
1162873065_1162873074 -7 Left 1162873065 19:13600326-13600348 CCACCTCCCAGGTGCCGGCCACA No data
Right 1162873074 19:13600342-13600364 GGCCACAGAGGGCGGGATGCTGG No data
1162873062_1162873074 8 Left 1162873062 19:13600311-13600333 CCGCGGGCACTCGCTCCACCTCC No data
Right 1162873074 19:13600342-13600364 GGCCACAGAGGGCGGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162873074 Original CRISPR GGCCACAGAGGGCGGGATGC TGG Intronic