ID: 1162880118

View in Genome Browser
Species Human (GRCh38)
Location 19:13652527-13652549
Sequence GGCCTGAGTAGAACAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162880118_1162880125 18 Left 1162880118 19:13652527-13652549 CCATCTTTTGTTCTACTCAGGCC No data
Right 1162880125 19:13652568-13652590 ATCCACCCAACTGGGGATGATGG No data
1162880118_1162880122 9 Left 1162880118 19:13652527-13652549 CCATCTTTTGTTCTACTCAGGCC No data
Right 1162880122 19:13652559-13652581 TTGGATGATATCCACCCAACTGG No data
1162880118_1162880124 11 Left 1162880118 19:13652527-13652549 CCATCTTTTGTTCTACTCAGGCC No data
Right 1162880124 19:13652561-13652583 GGATGATATCCACCCAACTGGGG No data
1162880118_1162880123 10 Left 1162880118 19:13652527-13652549 CCATCTTTTGTTCTACTCAGGCC No data
Right 1162880123 19:13652560-13652582 TGGATGATATCCACCCAACTGGG No data
1162880118_1162880119 -10 Left 1162880118 19:13652527-13652549 CCATCTTTTGTTCTACTCAGGCC No data
Right 1162880119 19:13652540-13652562 TACTCAGGCCCTCAACAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162880118 Original CRISPR GGCCTGAGTAGAACAAAAGA TGG (reversed) Intergenic
No off target data available for this crispr