ID: 1162882671

View in Genome Browser
Species Human (GRCh38)
Location 19:13671688-13671710
Sequence CTTGGATGGTACCTAGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162882662_1162882671 14 Left 1162882662 19:13671651-13671673 CCTTGGTACCTTGGTGCTGCATC No data
Right 1162882671 19:13671688-13671710 CTTGGATGGTACCTAGATGTGGG No data
1162882661_1162882671 20 Left 1162882661 19:13671645-13671667 CCTTTTCCTTGGTACCTTGGTGC No data
Right 1162882671 19:13671688-13671710 CTTGGATGGTACCTAGATGTGGG No data
1162882660_1162882671 21 Left 1162882660 19:13671644-13671666 CCCTTTTCCTTGGTACCTTGGTG No data
Right 1162882671 19:13671688-13671710 CTTGGATGGTACCTAGATGTGGG No data
1162882663_1162882671 6 Left 1162882663 19:13671659-13671681 CCTTGGTGCTGCATCTTATTTCC No data
Right 1162882671 19:13671688-13671710 CTTGGATGGTACCTAGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162882671 Original CRISPR CTTGGATGGTACCTAGATGT GGG Intergenic
No off target data available for this crispr