ID: 1162883210

View in Genome Browser
Species Human (GRCh38)
Location 19:13676069-13676091
Sequence CAGTATCTGCAGACACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162883210_1162883214 20 Left 1162883210 19:13676069-13676091 CCTTCCAGTGTCTGCAGATACTG No data
Right 1162883214 19:13676112-13676134 GTAGTCATGAGAGAAATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162883210 Original CRISPR CAGTATCTGCAGACACTGGA AGG (reversed) Intergenic
No off target data available for this crispr