ID: 1162883393

View in Genome Browser
Species Human (GRCh38)
Location 19:13677577-13677599
Sequence TTCTTTTTATTTATCCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162883393_1162883395 -10 Left 1162883393 19:13677577-13677599 CCAACCAGGATAAATAAAAAGAA No data
Right 1162883395 19:13677590-13677612 ATAAAAAGAAATATATGCCTAGG No data
1162883393_1162883396 0 Left 1162883393 19:13677577-13677599 CCAACCAGGATAAATAAAAAGAA No data
Right 1162883396 19:13677600-13677622 ATATATGCCTAGGCCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162883393 Original CRISPR TTCTTTTTATTTATCCTGGT TGG (reversed) Intergenic
No off target data available for this crispr