ID: 1162883396

View in Genome Browser
Species Human (GRCh38)
Location 19:13677600-13677622
Sequence ATATATGCCTAGGCCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162883393_1162883396 0 Left 1162883393 19:13677577-13677599 CCAACCAGGATAAATAAAAAGAA No data
Right 1162883396 19:13677600-13677622 ATATATGCCTAGGCCCATCTTGG No data
1162883394_1162883396 -4 Left 1162883394 19:13677581-13677603 CCAGGATAAATAAAAAGAAATAT No data
Right 1162883396 19:13677600-13677622 ATATATGCCTAGGCCCATCTTGG No data
1162883391_1162883396 30 Left 1162883391 19:13677547-13677569 CCACAGACTAAAGACGCACAGAG No data
Right 1162883396 19:13677600-13677622 ATATATGCCTAGGCCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162883396 Original CRISPR ATATATGCCTAGGCCCATCT TGG Intergenic
No off target data available for this crispr