ID: 1162883782

View in Genome Browser
Species Human (GRCh38)
Location 19:13681000-13681022
Sequence GGTTTTAAGAGGATCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162883777_1162883782 -3 Left 1162883777 19:13680980-13681002 CCCAAGGAGTTCTGAGCTGGGGT No data
Right 1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG No data
1162883770_1162883782 12 Left 1162883770 19:13680965-13680987 CCCCAAATCTGTCTCCCCAAGGA 0: 6
1: 14
2: 50
3: 103
4: 371
Right 1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG No data
1162883771_1162883782 11 Left 1162883771 19:13680966-13680988 CCCAAATCTGTCTCCCCAAGGAG No data
Right 1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG No data
1162883768_1162883782 13 Left 1162883768 19:13680964-13680986 CCCCCAAATCTGTCTCCCCAAGG No data
Right 1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG No data
1162883778_1162883782 -4 Left 1162883778 19:13680981-13681003 CCAAGGAGTTCTGAGCTGGGGTT No data
Right 1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG No data
1162883775_1162883782 -2 Left 1162883775 19:13680979-13681001 CCCCAAGGAGTTCTGAGCTGGGG No data
Right 1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG No data
1162883772_1162883782 10 Left 1162883772 19:13680967-13680989 CCAAATCTGTCTCCCCAAGGAGT No data
Right 1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162883782 Original CRISPR GGTTTTAAGAGGATCATGGA GGG Intergenic
No off target data available for this crispr