ID: 1162885018

View in Genome Browser
Species Human (GRCh38)
Location 19:13690540-13690562
Sequence TCTCTAGGTGGGACCAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162885018_1162885025 -4 Left 1162885018 19:13690540-13690562 CCAAAGCTGGTCCCACCTAGAGA No data
Right 1162885025 19:13690559-13690581 GAGACAAAGGAGAAGGGCTTTGG No data
1162885018_1162885026 17 Left 1162885018 19:13690540-13690562 CCAAAGCTGGTCCCACCTAGAGA No data
Right 1162885026 19:13690580-13690602 GGACCCTGTATTCATCAGCTTGG No data
1162885018_1162885023 -10 Left 1162885018 19:13690540-13690562 CCAAAGCTGGTCCCACCTAGAGA No data
Right 1162885023 19:13690553-13690575 CACCTAGAGACAAAGGAGAAGGG No data
1162885018_1162885027 18 Left 1162885018 19:13690540-13690562 CCAAAGCTGGTCCCACCTAGAGA No data
Right 1162885027 19:13690581-13690603 GACCCTGTATTCATCAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162885018 Original CRISPR TCTCTAGGTGGGACCAGCTT TGG (reversed) Intergenic