ID: 1162888301

View in Genome Browser
Species Human (GRCh38)
Location 19:13712944-13712966
Sequence TTTGAGAAGCTGAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162888295_1162888301 30 Left 1162888295 19:13712891-13712913 CCTTTCACAGCATGTCAGACAAA No data
Right 1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG No data
1162888297_1162888301 5 Left 1162888297 19:13712916-13712938 CCGGAGTGATTAAATGTTGAGTG No data
Right 1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162888301 Original CRISPR TTTGAGAAGCTGAAAGAGGA GGG Intergenic
No off target data available for this crispr