ID: 1162905848

View in Genome Browser
Species Human (GRCh38)
Location 19:13823445-13823467
Sequence CACACTGGCGGGTCTCCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162905848_1162905857 11 Left 1162905848 19:13823445-13823467 CCACCTGGAGACCCGCCAGTGTG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1162905857 19:13823479-13823501 ACCATGTTGACGGCCGCCAAGGG 0: 1
1: 0
2: 0
3: 6
4: 16
1162905848_1162905860 20 Left 1162905848 19:13823445-13823467 CCACCTGGAGACCCGCCAGTGTG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1162905860 19:13823488-13823510 ACGGCCGCCAAGGGTGAGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 269
1162905848_1162905854 1 Left 1162905848 19:13823445-13823467 CCACCTGGAGACCCGCCAGTGTG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1162905854 19:13823469-13823491 ACTGGCTTCCACCATGTTGACGG 0: 1
1: 0
2: 4
3: 28
4: 205
1162905848_1162905856 10 Left 1162905848 19:13823445-13823467 CCACCTGGAGACCCGCCAGTGTG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1162905856 19:13823478-13823500 CACCATGTTGACGGCCGCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 50
1162905848_1162905859 16 Left 1162905848 19:13823445-13823467 CCACCTGGAGACCCGCCAGTGTG 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1162905859 19:13823484-13823506 GTTGACGGCCGCCAAGGGTGAGG 0: 1
1: 0
2: 2
3: 1
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162905848 Original CRISPR CACACTGGCGGGTCTCCAGG TGG (reversed) Exonic