ID: 1162907354

View in Genome Browser
Species Human (GRCh38)
Location 19:13831627-13831649
Sequence TGGGCACTAGGGTCCCAGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 227}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162907340_1162907354 4 Left 1162907340 19:13831600-13831622 CCTATCCGGCCAGGACCCCCATT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1162907354 19:13831627-13831649 TGGGCACTAGGGTCCCAGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 227
1162907333_1162907354 18 Left 1162907333 19:13831586-13831608 CCTCACCCCCTTATCCTATCCGG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1162907354 19:13831627-13831649 TGGGCACTAGGGTCCCAGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 227
1162907338_1162907354 11 Left 1162907338 19:13831593-13831615 CCCTTATCCTATCCGGCCAGGAC 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1162907354 19:13831627-13831649 TGGGCACTAGGGTCCCAGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 227
1162907339_1162907354 10 Left 1162907339 19:13831594-13831616 CCTTATCCTATCCGGCCAGGACC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1162907354 19:13831627-13831649 TGGGCACTAGGGTCCCAGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 227
1162907335_1162907354 13 Left 1162907335 19:13831591-13831613 CCCCCTTATCCTATCCGGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1162907354 19:13831627-13831649 TGGGCACTAGGGTCCCAGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 227
1162907341_1162907354 -1 Left 1162907341 19:13831605-13831627 CCGGCCAGGACCCCCATTTCCTT 0: 1
1: 0
2: 2
3: 38
4: 296
Right 1162907354 19:13831627-13831649 TGGGCACTAGGGTCCCAGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 227
1162907337_1162907354 12 Left 1162907337 19:13831592-13831614 CCCCTTATCCTATCCGGCCAGGA 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162907354 19:13831627-13831649 TGGGCACTAGGGTCCCAGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 227
1162907332_1162907354 25 Left 1162907332 19:13831579-13831601 CCTCATACCTCACCCCCTTATCC 0: 1
1: 0
2: 2
3: 25
4: 287
Right 1162907354 19:13831627-13831649 TGGGCACTAGGGTCCCAGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 227
1162907344_1162907354 -5 Left 1162907344 19:13831609-13831631 CCAGGACCCCCATTTCCTTGGGC 0: 1
1: 0
2: 1
3: 17
4: 221
Right 1162907354 19:13831627-13831649 TGGGCACTAGGGTCCCAGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162907354 Original CRISPR TGGGCACTAGGGTCCCAGGG TGG Exonic
900611547 1:3546601-3546623 TGGGAAGGAGGGTGCCAGGGAGG + Intronic
900611599 1:3546739-3546761 TGGGAAGGAGGGTGCCAGGGAGG + Intronic
900864804 1:5260636-5260658 TGAGCACCAGGAGCCCAGGGAGG - Intergenic
901250001 1:7771112-7771134 GGGCCACAGGGGTCCCAGGGCGG - Intergenic
902350344 1:15848899-15848921 GGGGCACCAGGGTCTTAGGGCGG - Intronic
902605988 1:17569664-17569686 TGGGCACCGGTGTCCCAGGTTGG - Intronic
903325725 1:22567515-22567537 TGGCCCCTGGGGACCCAGGGAGG + Intronic
904788285 1:32998782-32998804 TGGGCACTGGGGCCACAGAGAGG - Intergenic
907188754 1:52632138-52632160 TGGGCCCTAGGGCCCCTGAGAGG - Intergenic
907221974 1:52913769-52913791 TGTACACTAGGGCCCCCGGGTGG - Intronic
907359943 1:53906304-53906326 TGGGGACAGGGGGCCCAGGGAGG + Intronic
907442654 1:54488589-54488611 AGGGCACAGGGGTCCCAGGCTGG - Intergenic
909495964 1:76279077-76279099 GGGCCACTTGGCTCCCAGGGAGG + Intronic
909597432 1:77422241-77422263 CTGGCCCTATGGTCCCAGGGAGG - Intronic
910290636 1:85597079-85597101 AAGGCACTTGGGTCACAGGGAGG + Intergenic
915327355 1:155087134-155087156 TGGGCATTGGGGTGCCAGGCAGG + Exonic
917028933 1:170668790-170668812 TGGGCCCCAGAGTCCCAGGATGG - Intronic
920444550 1:206006012-206006034 TGGGGACTAGAGTCTGAGGGTGG - Intergenic
920857084 1:209671816-209671838 TGGGCACTGGGGACACAGTGAGG + Intergenic
922705146 1:227786802-227786824 TGGGCACCTCAGTCCCAGGGAGG + Intergenic
922765167 1:228152707-228152729 TGGGGACCAGGGTCTCATGGGGG - Intronic
1062952469 10:1515287-1515309 CGGGCACCAGGTTCCCAGCGGGG - Intronic
1065009996 10:21412306-21412328 TGGTCTCTTGGGTACCAGGGTGG - Intergenic
1069595113 10:69665261-69665283 TGATCACTAAGGCCCCAGGGTGG + Intergenic
1072640129 10:97205474-97205496 CTGGCACTGGGGTCCCATGGGGG - Intronic
1073100370 10:101003409-101003431 TGGGCACTGGGGACCCAAGACGG + Intronic
1073149980 10:101304992-101305014 TGGGGAAGGGGGTCCCAGGGTGG - Intergenic
1073869166 10:107842413-107842435 TGGGCAAGAGGGTGGCAGGGTGG - Intergenic
1076340145 10:129739969-129739991 TGGCCACTGGGGGCCCAGGATGG + Intronic
1076427833 10:130380175-130380197 TGGGTGCTGTGGTCCCAGGGAGG - Intergenic
1077172210 11:1172139-1172161 TGGTCACTAGCGTCCCTGGAAGG + Intronic
1077663081 11:4086363-4086385 TTGGCATTAGAGGCCCAGGGTGG + Intronic
1079111544 11:17607910-17607932 TGAGCACCAGGGTCCCAGAGGGG + Intronic
1079422855 11:20310772-20310794 CGGTGACTAGGGGCCCAGGGAGG - Intergenic
1083282918 11:61638494-61638516 TGGGCACGAGGGTGACAGGGTGG - Intergenic
1083714053 11:64565590-64565612 GGGGTCCCAGGGTCCCAGGGAGG + Intronic
1083887102 11:65578239-65578261 TGGGCGCAGGGGTCCCAAGGAGG - Intronic
1084400633 11:68940948-68940970 GGGGCTCTAGTGGCCCAGGGTGG - Intergenic
1084689211 11:70715370-70715392 TAGGCACTGGGTGCCCAGGGTGG - Intronic
1085472398 11:76766715-76766737 CGGGCAGGAGGGTCCCAGGGAGG - Intergenic
1089961566 11:122621529-122621551 TAGACACTAGGGTCCCAAGATGG - Intergenic
1090190211 11:124762124-124762146 TGGTCACCAGGGGCCCCGGGAGG + Exonic
1091617602 12:2061506-2061528 TGGCCAGTAGGCTCCCAGGACGG + Intronic
1091779621 12:3205614-3205636 TGGGCTCAAGGGTCCCAGCAGGG + Intronic
1091815933 12:3437989-3438011 TGGGGTCTGGGGTCCCAAGGAGG + Intronic
1091911921 12:4239921-4239943 TGGGGACTAGGATGCCAGGTGGG + Intergenic
1092940866 12:13405816-13405838 TGGGCAACTGGGTGCCAGGGAGG - Intergenic
1095575540 12:43734073-43734095 TGTGGATTAGGGTCCCAGGAAGG + Intronic
1097181365 12:57173872-57173894 TTGGCACAAGGGTGCGAGGGTGG - Exonic
1097595361 12:61621713-61621735 TGGGGACTAGGATGCCAGGTAGG - Intergenic
1100214262 12:92431329-92431351 TGAGTGCTAGGGTCCCTGGGAGG + Intergenic
1103274700 12:119701562-119701584 TGGACACTAGGGACCCATGAGGG - Intronic
1104759331 12:131287496-131287518 TGGGGATTTGGGTCCCAGGGTGG + Intergenic
1104821279 12:131679000-131679022 TGGGGGTTTGGGTCCCAGGGTGG - Intergenic
1106533431 13:30617292-30617314 TGGGCTCTAGGGAGACAGGGAGG + Intronic
1107814549 13:44232630-44232652 AGGGCAATAGTGTCACAGGGAGG + Intergenic
1112332524 13:98487476-98487498 TGGGTAATGGGGGCCCAGGGTGG - Intronic
1112440808 13:99423346-99423368 AAGGCACCAGGGTCACAGGGAGG + Intergenic
1112457512 13:99575753-99575775 TGGGCGCTGGGGTGCCAGGTTGG - Intergenic
1115718004 14:36127057-36127079 GGGGTACTTGGGTCCCAGGGTGG - Intergenic
1116273810 14:42805382-42805404 TGGGCACTGGGGACCCAGTATGG - Intergenic
1117836954 14:59817707-59817729 AGGACACTAGGGTGGCAGGGTGG - Intronic
1118770452 14:68939305-68939327 TGGGCTCTTGGGTCCCTGGGAGG - Intronic
1119510848 14:75209903-75209925 TGGGCAGAAGAGTCCAAGGGAGG - Intergenic
1121048963 14:90807503-90807525 TGGGCAGCAGGGTCCCCTGGGGG - Intronic
1121237644 14:92404444-92404466 TGGGGACTGGGGGCTCAGGGAGG - Intronic
1121642409 14:95494591-95494613 TGGGCAATAGGGAGCCAGTGAGG + Intergenic
1122370503 14:101226616-101226638 TGGGCAGAGGGGTCCCAGGCTGG + Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1123103110 14:105818954-105818976 GGGGCACTGGGGCTCCAGGGTGG + Intergenic
1123946124 15:25239746-25239768 TGGACACCAGGGTGCCAGGAAGG - Intergenic
1124396486 15:29306276-29306298 TGGGCACAAGGATCCTTGGGGGG + Intronic
1127505864 15:59597155-59597177 TGGGCACTCGGGGGACAGGGTGG - Intronic
1129879390 15:78996882-78996904 TGGGCACTCTGGTCACAGGCAGG + Intronic
1130486359 15:84400517-84400539 TGGGCACCAGGGGGCCAGGCTGG - Intergenic
1131046346 15:89318886-89318908 TGGGCAGAGGGGCCCCAGGGAGG - Intronic
1132602579 16:780207-780229 GGGGCATCCGGGTCCCAGGGTGG + Intronic
1133335459 16:5004177-5004199 GGGGCAATAGGGACCCATGGAGG + Intronic
1135167396 16:20151628-20151650 TGAGCAATAGGGGCTCAGGGAGG + Intergenic
1137887338 16:52119119-52119141 TGGGGACTGGGGCCCCAGGTGGG - Intergenic
1138532078 16:57639883-57639905 GTGGCACTAGGGACCCTGGGGGG + Intronic
1140476938 16:75243808-75243830 TGGGCTCTAGTGTCCCAGCGAGG - Intronic
1141640127 16:85336024-85336046 GAGACACTAGGGTCCCAGGAAGG - Intergenic
1141895517 16:86956483-86956505 AGGGCCCTAGAGTCCAAGGGGGG - Intergenic
1142154060 16:88525209-88525231 TGGGCAGTGGGGTCCCAGCCAGG - Intronic
1143586253 17:7852103-7852125 TGGGAACTGGGGACCGAGGGCGG - Intronic
1144286830 17:13785315-13785337 TGGTCTCCAGGGTCCCAGTGGGG + Intergenic
1144659356 17:17058327-17058349 TGGGGAATGGGGACCCAGGGAGG + Intronic
1144659441 17:17058557-17058579 TGGGGAGTGGGGACCCAGGGAGG + Intronic
1145056135 17:19705305-19705327 TGGGCACGAGAGGCCCGGGGAGG + Intronic
1145071704 17:19815348-19815370 GGAGCACTGGGGTCCCTGGGAGG - Intronic
1146490075 17:33274784-33274806 TGGGCACTAGAGGCCCAGAGCGG + Intronic
1150269733 17:63855989-63856011 TGTGCATAAGGGTCCCCGGGAGG + Intergenic
1150283590 17:63943449-63943471 GGGCCACTGGGGTCCCAGGTGGG + Intronic
1151727338 17:75892622-75892644 TGGGCACAGGGGTCCTGGGGAGG - Intronic
1151894293 17:76969652-76969674 GGGGCACTAGGTTCTCCGGGCGG - Intergenic
1151978861 17:77497650-77497672 TGGCCACTAAGGGCCCAGTGAGG + Intronic
1152559055 17:81068755-81068777 GGGGGACTCCGGTCCCAGGGAGG + Intronic
1152669466 17:81593786-81593808 TGGGCACTGGGCACCCAGGAGGG - Intronic
1152741132 17:82018935-82018957 TGCACACTATTGTCCCAGGGAGG + Exonic
1153386366 18:4501971-4501993 TGGGCCCTTGGGACCCTGGGTGG - Intergenic
1154294295 18:13136033-13136055 TGGGGACTTGGGTCCCACGGTGG - Intergenic
1156007913 18:32465368-32465390 TGGACACTTAGGCCCCAGGGAGG - Intronic
1156487377 18:37475058-37475080 TTGGCTCTAGAGTCCCAGTGGGG + Intronic
1157518542 18:48328608-48328630 TGGGAACCTGGGGCCCAGGGAGG + Intronic
1157679877 18:49596751-49596773 GGGGCACCAGGGGACCAGGGCGG - Exonic
1159863300 18:73674503-73674525 TGGGAAGTAGAGTCCCAGGGAGG - Intergenic
1160539777 18:79614240-79614262 GGGGCGCCAGGGGCCCAGGGTGG + Intergenic
1160981941 19:1820207-1820229 TGGGGACTAGGGGTCCAGGGTGG - Intronic
1162070050 19:8147916-8147938 AGGGCAGCAGGGTCCCGGGGGGG + Intronic
1162320639 19:9969286-9969308 TGGTCACTAGGTGCCCAGAGTGG + Intronic
1162907354 19:13831627-13831649 TGGGCACTAGGGTCCCAGGGTGG + Exonic
1163366725 19:16879686-16879708 TGGCCGCGTGGGTCCCAGGGTGG - Exonic
1163760983 19:19136816-19136838 TCTGCACTAGGGTCCCGGGGAGG - Intronic
1164591445 19:29509747-29509769 TGGGCTTGAGGGTCCCAGGCTGG - Intergenic
1165834088 19:38743887-38743909 TGGGCTCTGGGGTCTGAGGGAGG - Intronic
1166010080 19:39935278-39935300 TGAGCACCTGGGTCCCTGGGTGG + Intergenic
1167592110 19:50409668-50409690 TGGGCACTCGGGCCCCTGGAAGG + Intronic
1167672170 19:50859577-50859599 AGGGCACTAGGGAGCCATGGAGG - Intronic
1167695077 19:51010363-51010385 TGGGCACCTGGGTCCTTGGGTGG - Intergenic
1167738370 19:51310856-51310878 TGGGCTCCAGGGTCTGAGGGAGG + Intergenic
1167738416 19:51310967-51310989 TGGGCTCCAGGGTCTGAGGGAGG + Intergenic
1167738462 19:51311078-51311100 TGGGCTCCAGGGTCTGAGGGAGG + Intergenic
1167798754 19:51727016-51727038 TGGGCTCCAGGGTCTGAGGGAGG - Intergenic
1168057139 19:53869976-53869998 TGGGCTCCTGGGTCCGAGGGAGG + Intronic
1168057156 19:53870013-53870035 TGGGCTCCTGGGTCCGAGGGAGG + Intronic
1168057215 19:53870159-53870181 TGGGCTCCTGGGTCCGAGGGAGG + Intronic
1168238064 19:55075995-55076017 TGGACTCCAGGGTCTCAGGGAGG + Intronic
1168253715 19:55155395-55155417 TGGACTCCAGGGTCTCAGGGAGG + Intronic
927010525 2:18899149-18899171 TGGAATCTAGGGTCCCTGGGTGG - Intergenic
928420940 2:31137670-31137692 TGCGCGCGAGGGTCCCGGGGCGG - Intronic
930555728 2:52894051-52894073 TGGGGACTAGGGTGCCAGATGGG + Intergenic
930620727 2:53640920-53640942 TGGCAAATAGGGTACCAGGGCGG - Intronic
932116390 2:69053452-69053474 TGTGCTCTAGGATCCCGGGGTGG + Intronic
932481243 2:72040694-72040716 TGGGCAGTAGGGAGCCATGGTGG - Intergenic
932573706 2:72951362-72951384 TGGGCCTTAGGGTGCCCGGGAGG - Intronic
933574798 2:84055177-84055199 GGGTGACTAGGGTCCCAGGTTGG - Intergenic
934032010 2:88056382-88056404 TGAGACCTAGAGTCCCAGGGAGG - Intergenic
934043370 2:88148121-88148143 TGGGAACTGGGGTACCAGGCAGG - Intergenic
934974258 2:98789439-98789461 TTGGGACTAGGGTCACAAGGAGG - Intergenic
938081579 2:128373121-128373143 TGGGGACTGGGGGCCCAGGAAGG + Intergenic
946092832 2:217246071-217246093 TGGGCACCAGGCTCTCTGGGAGG - Intergenic
947500543 2:230667974-230667996 TGGGTAGTAGGGGCCCAGGAAGG - Intergenic
947625278 2:231614770-231614792 GGGGCAGTAGGGGCCCTGGGAGG + Intergenic
947930241 2:233958887-233958909 TGGGCCGGTGGGTCCCAGGGAGG + Intronic
947939265 2:234035336-234035358 GGGGCTGTTGGGTCCCAGGGCGG - Intergenic
948209018 2:236178756-236178778 TGGGGACCAGGGTGGCAGGGAGG + Intergenic
948465977 2:238151774-238151796 GGGGCTGGAGGGTCCCAGGGAGG + Exonic
1169749889 20:8981072-8981094 TGGGCATAAGGGTACCAGAGAGG - Intergenic
1170629931 20:18057488-18057510 TGGGCGCTGGGCTCCCGGGGTGG - Intronic
1171177953 20:23068276-23068298 TGGGCCCTGGGGTCAGAGGGAGG - Intergenic
1173656693 20:44704563-44704585 TGGGCCCCAGGGTCTCGGGGGGG - Intergenic
1175222823 20:57427055-57427077 TGGTCAGTAGGGACCCGGGGAGG - Intergenic
1175404469 20:58717444-58717466 TGGGCCCTGGGATTCCAGGGAGG - Intronic
1176148027 20:63574096-63574118 TGAGCGCGGGGGTCCCAGGGTGG - Intronic
1176148056 20:63574160-63574182 TGAGCGCGGGGGTCCCAGGGCGG - Intronic
1176201614 20:63863323-63863345 GGGGCTGTGGGGTCCCAGGGAGG + Intergenic
1178537230 21:33420396-33420418 TGGGGACTAGAGTCCCACGTGGG + Intronic
1179380060 21:40890164-40890186 TGGTCACTGGAGGCCCAGGGAGG + Intergenic
1179659550 21:42865626-42865648 TGGGTGCTAGGATCCAAGGGAGG + Intronic
1179826244 21:43968145-43968167 TGAGCAGGAGGGTCCCGGGGAGG + Intronic
1180219672 21:46350634-46350656 TGGGGTCTAGGGTCTTAGGGAGG + Intronic
1181646555 22:24234363-24234385 TGGGGAGTGGAGTCCCAGGGTGG - Intronic
1182484270 22:30630014-30630036 TCGGCACTGGGGTCCAAGGTGGG - Intergenic
1183495423 22:38140648-38140670 TGGGCACTGGGGGTCCAGGTGGG + Intronic
1183507741 22:38218899-38218921 TGGCCCTGAGGGTCCCAGGGTGG + Intergenic
1183730027 22:39613274-39613296 TGGGCACTGGGGACCCAGCAGGG + Intronic
1183948638 22:41340512-41340534 TGGGTGCCAGGGACCCAGGGAGG + Intronic
1185059880 22:48600828-48600850 TGGTCACTTGGGAGCCAGGGCGG + Intronic
1185412165 22:50688500-50688522 TGCCCACTGGGGTCCCAGAGTGG + Intergenic
950543752 3:13627025-13627047 TGGGTACCAGGGATCCAGGGTGG + Intronic
953880664 3:46689777-46689799 TGGGCACTTGGGATCCATGGTGG - Intronic
954517957 3:51197203-51197225 TGGGGACTAGGATGCCAGGTGGG + Intronic
954542115 3:51400413-51400435 TGGGCAGAAGGGTCTCAGGCCGG - Intronic
954562385 3:51568708-51568730 TGAGCAGTAGGGTACCAGGTTGG + Intronic
954706868 3:52485613-52485635 TGGGCCCCAGGGTCCCAGAGTGG + Intronic
954716683 3:52530319-52530341 TGGGCTCTGGGGTCCCAAGGAGG + Intronic
955000589 3:54923801-54923823 TGGGCAACAGAGTCCCAGAGAGG - Intronic
958930151 3:100199098-100199120 TGGGGACTAGGGCACCAGGTAGG - Intergenic
960993102 3:123324513-123324535 GGGGCACCAGGTTCCCAGGTGGG - Intronic
961552964 3:127679611-127679633 TGGGAACTAGAGGCACAGGGAGG + Intronic
961620172 3:128217684-128217706 TGGGCAGTGGGGGACCAGGGGGG - Intronic
961867372 3:129963565-129963587 GGGGCACAAGGATCCCAGGGTGG + Intergenic
962157513 3:132963903-132963925 TGGCCAGAAGGGTGCCAGGGAGG + Intergenic
963091659 3:141487786-141487808 TAGCCACTCGGGCCCCAGGGCGG - Intronic
967105443 3:186251666-186251688 TAGACACTAGGGACCCAGAGGGG + Intronic
968520290 4:1032011-1032033 TGGGCCCTGGGCTCCCAGGACGG - Intergenic
968600170 4:1504999-1505021 GGGGCACTAGAGTCACTGGGGGG + Intergenic
968958473 4:3730692-3730714 TGGGGGCTGGGGCCCCAGGGCGG + Intergenic
969260896 4:6032827-6032849 TGGGCACCAGGGAGCCAGTGAGG + Intronic
969308404 4:6338573-6338595 TGGGCACTGGGGAGCCAAGGAGG - Intronic
971703618 4:30012358-30012380 TGGGAACTAGGATGCCAGGTGGG + Intergenic
982170469 4:152656398-152656420 TGGGGACTAGGATACCAGGTGGG - Intronic
983589634 4:169393623-169393645 TGGTAACTAGGATCCTAGGGAGG - Exonic
987556296 5:19455426-19455448 TGGTTACCAGGGTTCCAGGGAGG + Intergenic
994452150 5:99956075-99956097 AGGGCACCAGGGTGGCAGGGTGG + Intergenic
996856966 5:128019262-128019284 TGGGCAATAAGGTCCTAGGGGGG - Intergenic
997716663 5:136047798-136047820 TTGGAACCAGGGTCCTAGGGTGG - Intronic
1000305729 5:159992903-159992925 AGGGAAGTAGGGTCCCAAGGGGG - Intergenic
1001435331 5:171695330-171695352 TGGGCACTGAGGGGCCAGGGTGG - Intergenic
1001583511 5:172816858-172816880 TGGGCACTGGGGAGCCATGGAGG + Intergenic
1002637672 5:180616191-180616213 TGGTCAGTAGGGTCCCCTGGGGG + Intronic
1003173735 6:3739497-3739519 AGGGCACAAGGGTCCAAGAGGGG + Intronic
1004495760 6:16161051-16161073 TGGCCACCAGGGTCTCATGGGGG + Intergenic
1006280825 6:33051634-33051656 TGGGCACTGGGGACCCAGTATGG - Intergenic
1007751810 6:44075751-44075773 TGGGGACTTGGGCCCTAGGGGGG - Intergenic
1010265241 6:73858385-73858407 TGGGCACTGGAGTCACAGTGTGG - Intergenic
1010625825 6:78135346-78135368 TGGTCACTGGGGTCCCAGTATGG - Intergenic
1013272211 6:108555828-108555850 TGGGCTCTGGGGTCAGAGGGAGG + Intergenic
1013422471 6:109978967-109978989 TTTGCTCTGGGGTCCCAGGGTGG + Intronic
1013745401 6:113339543-113339565 TGGGCACTGGGGTCTGAAGGTGG - Intergenic
1014953888 6:127593105-127593127 TGAGCTCTAGGGTGACAGGGTGG - Intergenic
1018130750 6:160730393-160730415 TGGGAGCTAGTTTCCCAGGGTGG + Intronic
1019437832 7:1031057-1031079 GGGGCTCTAGGGTCTCAGTGTGG - Intronic
1022468567 7:30667365-30667387 TGGGCACCAGGGAGCCAGGGAGG - Intronic
1022503754 7:30897933-30897955 TGAGCACTAGGGAGCCATGGAGG + Intergenic
1026977543 7:74507715-74507737 TGGGCAGTAGGGAGCCATGGAGG + Intronic
1032500845 7:132398587-132398609 TGGGCTCCAGGGACGCAGGGAGG + Intronic
1032846892 7:135758861-135758883 TGCTCATTAGGATCCCAGGGAGG + Intergenic
1034559652 7:151871903-151871925 TGGGCACTAGGGGTCCGAGGAGG + Intronic
1034787689 7:153940512-153940534 GGGGAACTAAGGTCCCAGAGAGG + Intronic
1035353397 7:158262010-158262032 TGGGAACCAGGGGCTCAGGGCGG - Intronic
1035565352 8:637293-637315 AGGCCACTGAGGTCCCAGGGTGG - Intronic
1035580637 8:737591-737613 TGCGCACTCGGCGCCCAGGGAGG - Intronic
1036683085 8:10890262-10890284 GAGGCACTGGGGTTCCAGGGGGG - Intergenic
1037226749 8:16602041-16602063 TGCCCACTAGGGTCTCTGGGTGG - Intergenic
1038022715 8:23563577-23563599 TGGGCCCCAGGGTCCCAGGGAGG - Intronic
1039092509 8:33847392-33847414 TGGGCAGTGGAGTCCCAGGATGG - Intergenic
1041402211 8:57457665-57457687 TGAGCAGGTGGGTCCCAGGGTGG - Intergenic
1042560890 8:70071446-70071468 TCGCCACTAGGGTCCCAGGGAGG - Intronic
1042836583 8:73084584-73084606 TGTGTACAACGGTCCCAGGGTGG - Intronic
1049455331 8:142683612-142683634 TGAACACTGGGGGCCCAGGGTGG + Intergenic
1056995891 9:91459070-91459092 TGGGCACTAGAGGGACAGGGTGG - Intergenic
1057141073 9:92727151-92727173 GAGGCCCTAGGGGCCCAGGGAGG - Intronic
1057847436 9:98536559-98536581 TGGGCACTGCGGGCCCAGGAGGG - Intronic
1060944224 9:127560459-127560481 TTGTCCTTAGGGTCCCAGGGAGG - Intronic
1061673337 9:132201562-132201584 TGGGCACCAGGGACCCCTGGGGG + Intronic
1061985239 9:134126722-134126744 TGGGCACTGGGGTCCAAGTTAGG + Intergenic
1186045190 X:5528426-5528448 AGGAAACTAGGGTCCCATGGTGG - Intergenic
1186940459 X:14501303-14501325 TGGCCAGTTGGGTCCCAGGTGGG + Intergenic
1188085274 X:25895486-25895508 TGGGCGCTGGGGACCCAGGATGG - Intergenic
1192244612 X:69362209-69362231 TGGGGCCCAGGGACCCAGGGTGG - Intergenic
1192840576 X:74850517-74850539 TGGGCACTGGGATGCCAGGTAGG - Intronic
1196793365 X:119483448-119483470 TGGGCACCAGGGACACAGTGAGG + Intergenic
1197750447 X:129960338-129960360 TGGGCATTAGGGTGGCAGAGTGG - Intergenic
1201054553 Y:9975727-9975749 TGGGCATTAGGGACCCAGCATGG - Intergenic
1202068868 Y:20969497-20969519 TGGGCACTGGGGACCCAGTATGG - Intergenic