ID: 1162907843

View in Genome Browser
Species Human (GRCh38)
Location 19:13833974-13833996
Sequence CAGGAACATGGGAACATTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162907843_1162907856 29 Left 1162907843 19:13833974-13833996 CCACGAATGTTCCCATGTTCCTG No data
Right 1162907856 19:13834026-13834048 AATGTCCCCCCTTAAGAACTGGG No data
1162907843_1162907855 28 Left 1162907843 19:13833974-13833996 CCACGAATGTTCCCATGTTCCTG No data
Right 1162907855 19:13834025-13834047 AAATGTCCCCCCTTAAGAACTGG No data
1162907843_1162907849 -9 Left 1162907843 19:13833974-13833996 CCACGAATGTTCCCATGTTCCTG No data
Right 1162907849 19:13833988-13834010 ATGTTCCTGGGGCGTCACGCAGG No data
1162907843_1162907857 30 Left 1162907843 19:13833974-13833996 CCACGAATGTTCCCATGTTCCTG No data
Right 1162907857 19:13834027-13834049 ATGTCCCCCCTTAAGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162907843 Original CRISPR CAGGAACATGGGAACATTCG TGG (reversed) Intergenic
No off target data available for this crispr