ID: 1162907851

View in Genome Browser
Species Human (GRCh38)
Location 19:13834012-13834034
Sequence GGGGACATTTGGATGTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162907851_1162907855 -10 Left 1162907851 19:13834012-13834034 CCCAGCCACATCCAAATGTCCCC No data
Right 1162907855 19:13834025-13834047 AAATGTCCCCCCTTAAGAACTGG No data
1162907851_1162907856 -9 Left 1162907851 19:13834012-13834034 CCCAGCCACATCCAAATGTCCCC No data
Right 1162907856 19:13834026-13834048 AATGTCCCCCCTTAAGAACTGGG No data
1162907851_1162907857 -8 Left 1162907851 19:13834012-13834034 CCCAGCCACATCCAAATGTCCCC No data
Right 1162907857 19:13834027-13834049 ATGTCCCCCCTTAAGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162907851 Original CRISPR GGGGACATTTGGATGTGGCT GGG (reversed) Intergenic
No off target data available for this crispr