ID: 1162907852

View in Genome Browser
Species Human (GRCh38)
Location 19:13834013-13834035
Sequence GGGGGACATTTGGATGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162907852_1162907857 -9 Left 1162907852 19:13834013-13834035 CCAGCCACATCCAAATGTCCCCC No data
Right 1162907857 19:13834027-13834049 ATGTCCCCCCTTAAGAACTGGGG No data
1162907852_1162907856 -10 Left 1162907852 19:13834013-13834035 CCAGCCACATCCAAATGTCCCCC No data
Right 1162907856 19:13834026-13834048 AATGTCCCCCCTTAAGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162907852 Original CRISPR GGGGGACATTTGGATGTGGC TGG (reversed) Intergenic
No off target data available for this crispr