ID: 1162907857

View in Genome Browser
Species Human (GRCh38)
Location 19:13834027-13834049
Sequence ATGTCCCCCCTTAAGAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162907852_1162907857 -9 Left 1162907852 19:13834013-13834035 CCAGCCACATCCAAATGTCCCCC No data
Right 1162907857 19:13834027-13834049 ATGTCCCCCCTTAAGAACTGGGG No data
1162907847_1162907857 19 Left 1162907847 19:13833985-13834007 CCCATGTTCCTGGGGCGTCACGC No data
Right 1162907857 19:13834027-13834049 ATGTCCCCCCTTAAGAACTGGGG No data
1162907851_1162907857 -8 Left 1162907851 19:13834012-13834034 CCCAGCCACATCCAAATGTCCCC No data
Right 1162907857 19:13834027-13834049 ATGTCCCCCCTTAAGAACTGGGG No data
1162907843_1162907857 30 Left 1162907843 19:13833974-13833996 CCACGAATGTTCCCATGTTCCTG No data
Right 1162907857 19:13834027-13834049 ATGTCCCCCCTTAAGAACTGGGG No data
1162907850_1162907857 11 Left 1162907850 19:13833993-13834015 CCTGGGGCGTCACGCAGGTCCCA No data
Right 1162907857 19:13834027-13834049 ATGTCCCCCCTTAAGAACTGGGG No data
1162907848_1162907857 18 Left 1162907848 19:13833986-13834008 CCATGTTCCTGGGGCGTCACGCA No data
Right 1162907857 19:13834027-13834049 ATGTCCCCCCTTAAGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162907857 Original CRISPR ATGTCCCCCCTTAAGAACTG GGG Intergenic
No off target data available for this crispr