ID: 1162909306

View in Genome Browser
Species Human (GRCh38)
Location 19:13840774-13840796
Sequence GTCCACCCAGGACACCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162909295_1162909306 13 Left 1162909295 19:13840738-13840760 CCCTAAAGGACACACCTTCCCCA No data
Right 1162909306 19:13840774-13840796 GTCCACCCAGGACACCAGGAGGG No data
1162909296_1162909306 12 Left 1162909296 19:13840739-13840761 CCTAAAGGACACACCTTCCCCAG No data
Right 1162909306 19:13840774-13840796 GTCCACCCAGGACACCAGGAGGG No data
1162909294_1162909306 17 Left 1162909294 19:13840734-13840756 CCGGCCCTAAAGGACACACCTTC No data
Right 1162909306 19:13840774-13840796 GTCCACCCAGGACACCAGGAGGG No data
1162909299_1162909306 -6 Left 1162909299 19:13840757-13840779 CCCAGACACACCTCCGTGTCCAC No data
Right 1162909306 19:13840774-13840796 GTCCACCCAGGACACCAGGAGGG No data
1162909300_1162909306 -7 Left 1162909300 19:13840758-13840780 CCAGACACACCTCCGTGTCCACC No data
Right 1162909306 19:13840774-13840796 GTCCACCCAGGACACCAGGAGGG No data
1162909297_1162909306 -1 Left 1162909297 19:13840752-13840774 CCTTCCCCAGACACACCTCCGTG No data
Right 1162909306 19:13840774-13840796 GTCCACCCAGGACACCAGGAGGG No data
1162909298_1162909306 -5 Left 1162909298 19:13840756-13840778 CCCCAGACACACCTCCGTGTCCA No data
Right 1162909306 19:13840774-13840796 GTCCACCCAGGACACCAGGAGGG No data
1162909292_1162909306 26 Left 1162909292 19:13840725-13840747 CCCAGGCGACCGGCCCTAAAGGA No data
Right 1162909306 19:13840774-13840796 GTCCACCCAGGACACCAGGAGGG No data
1162909290_1162909306 30 Left 1162909290 19:13840721-13840743 CCTTCCCAGGCGACCGGCCCTAA No data
Right 1162909306 19:13840774-13840796 GTCCACCCAGGACACCAGGAGGG No data
1162909293_1162909306 25 Left 1162909293 19:13840726-13840748 CCAGGCGACCGGCCCTAAAGGAC No data
Right 1162909306 19:13840774-13840796 GTCCACCCAGGACACCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162909306 Original CRISPR GTCCACCCAGGACACCAGGA GGG Intergenic
No off target data available for this crispr