ID: 1162913095

View in Genome Browser
Species Human (GRCh38)
Location 19:13860542-13860564
Sequence CTGGAATTACAGATGGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162913095_1162913105 18 Left 1162913095 19:13860542-13860564 CCGGGCTCCATCTGTAATTCCAG No data
Right 1162913105 19:13860583-13860605 TGGGCGGATTGCCTGAGCTCAGG 0: 205
1: 1400
2: 5461
3: 27761
4: 90265
1162913095_1162913104 2 Left 1162913095 19:13860542-13860564 CCGGGCTCCATCTGTAATTCCAG No data
Right 1162913104 19:13860567-13860589 CTTTGGGAGGCTGAGGTGGGCGG 0: 23522
1: 76482
2: 160024
3: 176046
4: 158971
1162913095_1162913100 -5 Left 1162913095 19:13860542-13860564 CCGGGCTCCATCTGTAATTCCAG No data
Right 1162913100 19:13860560-13860582 TCCAGCACTTTGGGAGGCTGAGG 0: 4261
1: 95514
2: 216800
3: 242347
4: 268001
1162913095_1162913103 -1 Left 1162913095 19:13860542-13860564 CCGGGCTCCATCTGTAATTCCAG No data
Right 1162913103 19:13860564-13860586 GCACTTTGGGAGGCTGAGGTGGG 0: 31080
1: 132897
2: 232009
3: 232314
4: 247325
1162913095_1162913102 -2 Left 1162913095 19:13860542-13860564 CCGGGCTCCATCTGTAATTCCAG No data
Right 1162913102 19:13860563-13860585 AGCACTTTGGGAGGCTGAGGTGG 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162913095 Original CRISPR CTGGAATTACAGATGGAGCC CGG (reversed) Intergenic
No off target data available for this crispr