ID: 1162913434

View in Genome Browser
Species Human (GRCh38)
Location 19:13862074-13862096
Sequence ATTCCTGGATCCTGGCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162913434_1162913441 15 Left 1162913434 19:13862074-13862096 CCACTGGGCCAGGATCCAGGAAT 0: 1
1: 0
2: 3
3: 18
4: 218
Right 1162913441 19:13862112-13862134 GACCCAGTTCAGGAATGCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 195
1162913434_1162913444 28 Left 1162913434 19:13862074-13862096 CCACTGGGCCAGGATCCAGGAAT 0: 1
1: 0
2: 3
3: 18
4: 218
Right 1162913444 19:13862125-13862147 AATGCAGAGGCCGCCCGCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 101
1162913434_1162913439 5 Left 1162913434 19:13862074-13862096 CCACTGGGCCAGGATCCAGGAAT 0: 1
1: 0
2: 3
3: 18
4: 218
Right 1162913439 19:13862102-13862124 CTCCTGGTCTGACCCAGTTCAGG 0: 1
1: 0
2: 1
3: 19
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162913434 Original CRISPR ATTCCTGGATCCTGGCCCAG TGG (reversed) Intronic