ID: 1162914114

View in Genome Browser
Species Human (GRCh38)
Location 19:13865300-13865322
Sequence GCGGGGGCTCCCTAGGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162914114_1162914129 16 Left 1162914114 19:13865300-13865322 CCCACGGCCTAGGGAGCCCCCGC No data
Right 1162914129 19:13865339-13865361 CGAAATGCAATTTCCCGTGCAGG No data
1162914114_1162914130 24 Left 1162914114 19:13865300-13865322 CCCACGGCCTAGGGAGCCCCCGC No data
Right 1162914130 19:13865347-13865369 AATTTCCCGTGCAGGCGCCTCGG No data
1162914114_1162914134 30 Left 1162914114 19:13865300-13865322 CCCACGGCCTAGGGAGCCCCCGC No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914114_1162914131 25 Left 1162914114 19:13865300-13865322 CCCACGGCCTAGGGAGCCCCCGC No data
Right 1162914131 19:13865348-13865370 ATTTCCCGTGCAGGCGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162914114 Original CRISPR GCGGGGGCTCCCTAGGCCGT GGG (reversed) Intronic