ID: 1162914115

View in Genome Browser
Species Human (GRCh38)
Location 19:13865301-13865323
Sequence GGCGGGGGCTCCCTAGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162914115_1162914134 29 Left 1162914115 19:13865301-13865323 CCACGGCCTAGGGAGCCCCCGCC No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914115_1162914135 30 Left 1162914115 19:13865301-13865323 CCACGGCCTAGGGAGCCCCCGCC No data
Right 1162914135 19:13865354-13865376 CGTGCAGGCGCCTCGGGCCCGGG No data
1162914115_1162914131 24 Left 1162914115 19:13865301-13865323 CCACGGCCTAGGGAGCCCCCGCC No data
Right 1162914131 19:13865348-13865370 ATTTCCCGTGCAGGCGCCTCGGG No data
1162914115_1162914130 23 Left 1162914115 19:13865301-13865323 CCACGGCCTAGGGAGCCCCCGCC No data
Right 1162914130 19:13865347-13865369 AATTTCCCGTGCAGGCGCCTCGG No data
1162914115_1162914129 15 Left 1162914115 19:13865301-13865323 CCACGGCCTAGGGAGCCCCCGCC No data
Right 1162914129 19:13865339-13865361 CGAAATGCAATTTCCCGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162914115 Original CRISPR GGCGGGGGCTCCCTAGGCCG TGG (reversed) Intronic