ID: 1162914116

View in Genome Browser
Species Human (GRCh38)
Location 19:13865307-13865329
Sequence GGGCAGGGCGGGGGCTCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162914116_1162914129 9 Left 1162914116 19:13865307-13865329 CCTAGGGAGCCCCCGCCCTGCCC No data
Right 1162914129 19:13865339-13865361 CGAAATGCAATTTCCCGTGCAGG No data
1162914116_1162914135 24 Left 1162914116 19:13865307-13865329 CCTAGGGAGCCCCCGCCCTGCCC No data
Right 1162914135 19:13865354-13865376 CGTGCAGGCGCCTCGGGCCCGGG No data
1162914116_1162914134 23 Left 1162914116 19:13865307-13865329 CCTAGGGAGCCCCCGCCCTGCCC No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914116_1162914136 25 Left 1162914116 19:13865307-13865329 CCTAGGGAGCCCCCGCCCTGCCC No data
Right 1162914136 19:13865355-13865377 GTGCAGGCGCCTCGGGCCCGGGG No data
1162914116_1162914130 17 Left 1162914116 19:13865307-13865329 CCTAGGGAGCCCCCGCCCTGCCC No data
Right 1162914130 19:13865347-13865369 AATTTCCCGTGCAGGCGCCTCGG No data
1162914116_1162914131 18 Left 1162914116 19:13865307-13865329 CCTAGGGAGCCCCCGCCCTGCCC No data
Right 1162914131 19:13865348-13865370 ATTTCCCGTGCAGGCGCCTCGGG No data
1162914116_1162914137 26 Left 1162914116 19:13865307-13865329 CCTAGGGAGCCCCCGCCCTGCCC No data
Right 1162914137 19:13865356-13865378 TGCAGGCGCCTCGGGCCCGGGGG No data
1162914116_1162914138 27 Left 1162914116 19:13865307-13865329 CCTAGGGAGCCCCCGCCCTGCCC No data
Right 1162914138 19:13865357-13865379 GCAGGCGCCTCGGGCCCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162914116 Original CRISPR GGGCAGGGCGGGGGCTCCCT AGG (reversed) Intronic