ID: 1162914123

View in Genome Browser
Species Human (GRCh38)
Location 19:13865323-13865345
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162914123_1162914142 24 Left 1162914123 19:13865323-13865345 CCTGCCCCGGAGCCGCCGAAATG No data
Right 1162914142 19:13865370-13865392 GCCCGGGGGGCTTTTCCGGGCGG No data
1162914123_1162914144 25 Left 1162914123 19:13865323-13865345 CCTGCCCCGGAGCCGCCGAAATG No data
Right 1162914144 19:13865371-13865393 CCCGGGGGGCTTTTCCGGGCGGG No data
1162914123_1162914129 -7 Left 1162914123 19:13865323-13865345 CCTGCCCCGGAGCCGCCGAAATG No data
Right 1162914129 19:13865339-13865361 CGAAATGCAATTTCCCGTGCAGG No data
1162914123_1162914130 1 Left 1162914123 19:13865323-13865345 CCTGCCCCGGAGCCGCCGAAATG No data
Right 1162914130 19:13865347-13865369 AATTTCCCGTGCAGGCGCCTCGG No data
1162914123_1162914141 21 Left 1162914123 19:13865323-13865345 CCTGCCCCGGAGCCGCCGAAATG No data
Right 1162914141 19:13865367-13865389 CGGGCCCGGGGGGCTTTTCCGGG No data
1162914123_1162914137 10 Left 1162914123 19:13865323-13865345 CCTGCCCCGGAGCCGCCGAAATG No data
Right 1162914137 19:13865356-13865378 TGCAGGCGCCTCGGGCCCGGGGG No data
1162914123_1162914134 7 Left 1162914123 19:13865323-13865345 CCTGCCCCGGAGCCGCCGAAATG No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914123_1162914135 8 Left 1162914123 19:13865323-13865345 CCTGCCCCGGAGCCGCCGAAATG No data
Right 1162914135 19:13865354-13865376 CGTGCAGGCGCCTCGGGCCCGGG No data
1162914123_1162914140 20 Left 1162914123 19:13865323-13865345 CCTGCCCCGGAGCCGCCGAAATG No data
Right 1162914140 19:13865366-13865388 TCGGGCCCGGGGGGCTTTTCCGG No data
1162914123_1162914138 11 Left 1162914123 19:13865323-13865345 CCTGCCCCGGAGCCGCCGAAATG No data
Right 1162914138 19:13865357-13865379 GCAGGCGCCTCGGGCCCGGGGGG No data
1162914123_1162914131 2 Left 1162914123 19:13865323-13865345 CCTGCCCCGGAGCCGCCGAAATG No data
Right 1162914131 19:13865348-13865370 ATTTCCCGTGCAGGCGCCTCGGG No data
1162914123_1162914136 9 Left 1162914123 19:13865323-13865345 CCTGCCCCGGAGCCGCCGAAATG No data
Right 1162914136 19:13865355-13865377 GTGCAGGCGCCTCGGGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162914123 Original CRISPR CATTTCGGCGGCTCCGGGGC AGG (reversed) Intronic