ID: 1162914128

View in Genome Browser
Species Human (GRCh38)
Location 19:13865338-13865360
Sequence CTGCACGGGAAATTGCATTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162914128_1162914140 5 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914140 19:13865366-13865388 TCGGGCCCGGGGGGCTTTTCCGG No data
1162914128_1162914144 10 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914144 19:13865371-13865393 CCCGGGGGGCTTTTCCGGGCGGG No data
1162914128_1162914137 -5 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914137 19:13865356-13865378 TGCAGGCGCCTCGGGCCCGGGGG No data
1162914128_1162914134 -8 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914128_1162914146 16 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914146 19:13865377-13865399 GGGCTTTTCCGGGCGGGTTTTGG No data
1162914128_1162914141 6 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914141 19:13865367-13865389 CGGGCCCGGGGGGCTTTTCCGGG No data
1162914128_1162914136 -6 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914136 19:13865355-13865377 GTGCAGGCGCCTCGGGCCCGGGG No data
1162914128_1162914151 29 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914151 19:13865390-13865412 CGGGTTTTGGAAAGAAGAGGGGG No data
1162914128_1162914142 9 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914142 19:13865370-13865392 GCCCGGGGGGCTTTTCCGGGCGG No data
1162914128_1162914138 -4 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914138 19:13865357-13865379 GCAGGCGCCTCGGGCCCGGGGGG No data
1162914128_1162914150 28 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914150 19:13865389-13865411 GCGGGTTTTGGAAAGAAGAGGGG No data
1162914128_1162914148 26 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914148 19:13865387-13865409 GGGCGGGTTTTGGAAAGAAGAGG No data
1162914128_1162914135 -7 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914135 19:13865354-13865376 CGTGCAGGCGCCTCGGGCCCGGG No data
1162914128_1162914149 27 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914149 19:13865388-13865410 GGCGGGTTTTGGAAAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162914128 Original CRISPR CTGCACGGGAAATTGCATTT CGG (reversed) Intronic