ID: 1162914134

View in Genome Browser
Species Human (GRCh38)
Location 19:13865353-13865375
Sequence CCGTGCAGGCGCCTCGGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162914120_1162914134 12 Left 1162914120 19:13865318-13865340 CCCGCCCTGCCCCGGAGCCGCCG No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914127_1162914134 -5 Left 1162914127 19:13865335-13865357 CCGCCGAAATGCAATTTCCCGTG No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914121_1162914134 11 Left 1162914121 19:13865319-13865341 CCGCCCTGCCCCGGAGCCGCCGA No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914125_1162914134 2 Left 1162914125 19:13865328-13865350 CCCGGAGCCGCCGAAATGCAATT No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914128_1162914134 -8 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914124_1162914134 3 Left 1162914124 19:13865327-13865349 CCCCGGAGCCGCCGAAATGCAAT No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914114_1162914134 30 Left 1162914114 19:13865300-13865322 CCCACGGCCTAGGGAGCCCCCGC No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914115_1162914134 29 Left 1162914115 19:13865301-13865323 CCACGGCCTAGGGAGCCCCCGCC No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914118_1162914134 14 Left 1162914118 19:13865316-13865338 CCCCCGCCCTGCCCCGGAGCCGC No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914122_1162914134 8 Left 1162914122 19:13865322-13865344 CCCTGCCCCGGAGCCGCCGAAAT No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914116_1162914134 23 Left 1162914116 19:13865307-13865329 CCTAGGGAGCCCCCGCCCTGCCC No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914119_1162914134 13 Left 1162914119 19:13865317-13865339 CCCCGCCCTGCCCCGGAGCCGCC No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914123_1162914134 7 Left 1162914123 19:13865323-13865345 CCTGCCCCGGAGCCGCCGAAATG No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data
1162914126_1162914134 1 Left 1162914126 19:13865329-13865351 CCGGAGCCGCCGAAATGCAATTT No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162914134 Original CRISPR CCGTGCAGGCGCCTCGGGCC CGG Intronic