ID: 1162914134

View in Genome Browser
Species Human (GRCh38)
Location 19:13865353-13865375
Sequence CCGTGCAGGCGCCTCGGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 194}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162914126_1162914134 1 Left 1162914126 19:13865329-13865351 CCGGAGCCGCCGAAATGCAATTT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 194
1162914127_1162914134 -5 Left 1162914127 19:13865335-13865357 CCGCCGAAATGCAATTTCCCGTG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 194
1162914119_1162914134 13 Left 1162914119 19:13865317-13865339 CCCCGCCCTGCCCCGGAGCCGCC 0: 1
1: 1
2: 7
3: 139
4: 910
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 194
1162914121_1162914134 11 Left 1162914121 19:13865319-13865341 CCGCCCTGCCCCGGAGCCGCCGA 0: 1
1: 0
2: 1
3: 33
4: 333
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 194
1162914120_1162914134 12 Left 1162914120 19:13865318-13865340 CCCGCCCTGCCCCGGAGCCGCCG 0: 1
1: 0
2: 9
3: 64
4: 659
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 194
1162914123_1162914134 7 Left 1162914123 19:13865323-13865345 CCTGCCCCGGAGCCGCCGAAATG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 194
1162914118_1162914134 14 Left 1162914118 19:13865316-13865338 CCCCCGCCCTGCCCCGGAGCCGC 0: 1
1: 0
2: 8
3: 80
4: 750
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 194
1162914116_1162914134 23 Left 1162914116 19:13865307-13865329 CCTAGGGAGCCCCCGCCCTGCCC No data
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 194
1162914114_1162914134 30 Left 1162914114 19:13865300-13865322 CCCACGGCCTAGGGAGCCCCCGC 0: 1
1: 1
2: 1
3: 19
4: 345
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 194
1162914122_1162914134 8 Left 1162914122 19:13865322-13865344 CCCTGCCCCGGAGCCGCCGAAAT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 194
1162914125_1162914134 2 Left 1162914125 19:13865328-13865350 CCCGGAGCCGCCGAAATGCAATT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 194
1162914128_1162914134 -8 Left 1162914128 19:13865338-13865360 CCGAAATGCAATTTCCCGTGCAG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 194
1162914115_1162914134 29 Left 1162914115 19:13865301-13865323 CCACGGCCTAGGGAGCCCCCGCC 0: 1
1: 1
2: 1
3: 25
4: 386
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 194
1162914124_1162914134 3 Left 1162914124 19:13865327-13865349 CCCCGGAGCCGCCGAAATGCAAT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162914134 Original CRISPR CCGTGCAGGCGCCTCGGGCC CGG Intronic
900121725 1:1051179-1051201 GCGTGCAGGTGCCTGGGCCCTGG + Intronic
900176801 1:1294679-1294701 CTGGGCAGGGGCCTCGGGCGAGG + Intronic
901019757 1:6249699-6249721 CCGCGCCGCCGCCCCGGGCCCGG - Exonic
901530520 1:9849734-9849756 CCGTCCAGGCCCCACCGGCCAGG - Exonic
901551341 1:9997788-9997810 CCGTGCAGGCCCCGGGGCCCCGG + Intronic
902271997 1:15311231-15311253 CCGTGCAGCCCCCTCCCGCCTGG - Intronic
902398529 1:16145146-16145168 CCCTGCTGGCGCCTCAGCCCTGG - Intronic
902813419 1:18902412-18902434 CCGAGCGCGCGCCTGGGGCCCGG - Intronic
903064320 1:20690270-20690292 CCGAGCAGGAGTCTCGGGCCAGG - Exonic
903132682 1:21290023-21290045 AGGTCCAGGCGCCCCGGGCCCGG - Intronic
904820345 1:33238894-33238916 CCATGCAGGTGCCTCGATCCTGG + Intergenic
907281448 1:53349727-53349749 CCGGGGAGGCCCCTCAGGCCAGG - Intergenic
913186647 1:116374611-116374633 CCGTGCAGGAGACTGGGCCCTGG + Intronic
913231294 1:116742613-116742635 CTGAGCAGGTGCCTGGGGCCAGG + Intergenic
913449040 1:118979947-118979969 CCTTGGAGGCGCCGCGGGGCCGG - Intronic
914899929 1:151706446-151706468 CCCTGCAGGTGCCACTGGCCTGG - Intronic
915171083 1:153977577-153977599 CCGTGGAGGATCCTCGGGCGCGG + Exonic
917920105 1:179743739-179743761 CGGTGCTCGCGCCTCGGGGCCGG + Intronic
923595941 1:235361036-235361058 CAGGGCAGGGGCCCCGGGCCTGG - Intergenic
1065186615 10:23174911-23174933 CCGGGGAGGGGCCTCCGGCCTGG + Intergenic
1067060920 10:43077517-43077539 CGGGCCGGGCGCCTCGGGCCGGG + Intronic
1069657199 10:70098735-70098757 CCGAGGAGGCGCGTCGTGCCTGG + Intronic
1070305139 10:75235167-75235189 CCGTGAAGGTGCCTGGGACCAGG + Exonic
1072556043 10:96514134-96514156 CCGGGCAGGCGCCTTAGGCTGGG - Intergenic
1074864726 10:117537995-117538017 CCATTCTCGCGCCTCGGGCCGGG + Intergenic
1076036297 10:127201297-127201319 CCGTGCAAGAGCCACGGGCAAGG - Intronic
1076484756 10:130808816-130808838 CAGTGCAGGAGCCCCCGGCCTGG - Intergenic
1076690211 10:132219859-132219881 CCGTGCAGCCTCCTCAGACCTGG - Intronic
1076838135 10:133031635-133031657 CTGGGCAGGTGCCTCCGGCCAGG - Intergenic
1077082189 11:729085-729107 CCGAGCAGGCAGCTGGGGCCAGG - Intergenic
1083812090 11:65111893-65111915 AGGTGCAGGCGCCGCGGGGCCGG + Exonic
1085725361 11:78950293-78950315 CCATTCAGGGGCCTCTGGCCAGG + Intronic
1089585431 11:119507589-119507611 CCGGGCAGCCGCCCCGTGCCGGG - Intergenic
1092256153 12:6927854-6927876 CCGGGTCGGGGCCTCGGGCCGGG + Intronic
1095839532 12:46677353-46677375 CCTGGCAGGTTCCTCGGGCCAGG - Intergenic
1098369070 12:69738666-69738688 CCGCGGAGGAACCTCGGGCCAGG + Intronic
1101877158 12:108603487-108603509 CCGTGGAGGGGCCTCCCGCCTGG + Intergenic
1102438174 12:112941566-112941588 CCAGGGAGGCTCCTCGGGCCGGG + Exonic
1102961926 12:117098911-117098933 CAGGGCAGGTGCCTCAGGCCGGG - Intronic
1103477382 12:121228898-121228920 CCCTGGAGGCGTCTCGTGCCAGG + Intronic
1103786319 12:123436038-123436060 CCCCGCAGGCGCCGTGGGCCCGG + Intronic
1104599494 12:130142837-130142859 CCCTGCAGGTGCCCCGGCCCAGG - Intergenic
1104634978 12:130432722-130432744 CCCTGCTGGTGCCTCGGCCCTGG + Intronic
1104886294 12:132110880-132110902 CAGGGCTGGCGCCTCTGGCCTGG + Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1112402474 13:99087702-99087724 CTGAGCATGCGCCGCGGGCCTGG - Intergenic
1114630659 14:24157548-24157570 GCATGCAGCCTCCTCGGGCCAGG - Exonic
1116974018 14:51095618-51095640 CCGTGCAGAAGCCTAGGCCCGGG - Exonic
1117978539 14:61321165-61321187 CCGTGCCCCCGCCTCCGGCCAGG + Intronic
1119410322 14:74426182-74426204 GCGCGGAGCCGCCTCGGGCCGGG - Intergenic
1120229729 14:81829542-81829564 CCGTGCAGGAGCCCAGGGCTTGG + Intergenic
1122064035 14:99159411-99159433 CAGTGCATGAGCCTCGGGCTGGG - Intergenic
1122779744 14:104138626-104138648 CCATGGGGGCGCCTCGGGGCCGG + Intergenic
1123008524 14:105335950-105335972 CTGTGCAGGCACCTGGAGCCTGG + Intronic
1123630743 15:22258206-22258228 GCGCGCGGGCGCCGCGGGCCGGG - Intergenic
1128099839 15:64989735-64989757 CCGTGGAGGCGGCTGGGCCCGGG + Exonic
1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG + Intronic
1129614468 15:77087407-77087429 CTGTGCAGGGGCCTGGGGCTGGG - Intergenic
1129742396 15:77995778-77995800 CCTTGCAGGGGCCACGGGCTGGG + Exonic
1129843087 15:78755699-78755721 CCTTGCAGGGGCCACGGGCTGGG - Intergenic
1132143937 15:99415681-99415703 CAGTGCAGGCGCGGCAGGCCCGG - Intergenic
1132552354 16:558839-558861 CCGTGCAGGCAGCTCCGGGCCGG - Intergenic
1132670420 16:1100205-1100227 CCGTGCAGGCTCCGCCCGCCAGG + Intergenic
1133258879 16:4535800-4535822 AGGTGGAGGCGCCTAGGGCCTGG - Intronic
1133259421 16:4538555-4538577 CCGCCCAGGCGCCGCGGGCGGGG + Intronic
1133286142 16:4691813-4691835 CTGTGCAGAGGCCTGGGGCCGGG - Intergenic
1133337310 16:5014610-5014632 CCATGCAAGGGCCTCAGGCCAGG + Intronic
1133757685 16:8774919-8774941 CCGTGCAGCCTCCTCCGGTCTGG - Exonic
1135517707 16:23149308-23149330 CCGTGGCGGGGCCGCGGGCCGGG - Intergenic
1140221703 16:73048439-73048461 CCGCGCACCCGCCTGGGGCCAGG + Intronic
1141731446 16:85825562-85825584 ATGTGCAGGTGGCTCGGGCCGGG - Intergenic
1141972302 16:87492367-87492389 GCGCGCGGGCGCCGCGGGCCGGG + Intergenic
1142194238 16:88732247-88732269 CCGTGCAGGCACCGCAAGCCTGG - Intronic
1142256417 16:89015795-89015817 GGGTGCAGGAGCCTCGGGCAGGG - Intergenic
1145970168 17:28951488-28951510 CCGCGCAGGCGCCCCGGGATCGG + Exonic
1147210437 17:38869977-38869999 GCGGGCACGCGCCTCGGGCGCGG - Exonic
1147970937 17:44218965-44218987 CGGTGGCGGCGCCTCTGGCCGGG - Intronic
1148722481 17:49763877-49763899 CCGTGCAGGTGAGCCGGGCCTGG - Exonic
1150125407 17:62631708-62631730 CACTGCAGGCGGCTCGGTCCAGG - Intronic
1150823833 17:68457482-68457504 CCGCGCCGGCTCCACGGGCCGGG + Intronic
1152617815 17:81345971-81345993 CCGGGCAGGAGCCCCGGGGCGGG + Intergenic
1152782366 17:82231947-82231969 CTTTGCAGGCGCCTGGGGCGGGG + Intronic
1160420920 18:78743321-78743343 TCGTGCAGAGGCCTCAGGCCTGG - Intergenic
1160618355 18:80151081-80151103 CTGTGAAGGGGCATCGGGCCTGG + Intronic
1161000456 19:1908119-1908141 CCGTGCGGGCCTCTCGGTCCTGG + Intronic
1161025469 19:2034815-2034837 CCATGCAGGCTCCTGGGGCAGGG + Intronic
1161063143 19:2225235-2225257 CCGTGCAGCCACCCTGGGCCAGG - Intronic
1161581864 19:5085631-5085653 CCAGGCAGGCGCCCAGGGCCTGG + Intronic
1161790352 19:6355866-6355888 CCGGCCAGCCGCCTCGGTCCGGG + Intergenic
1162550534 19:11355738-11355760 CGGTGCTGGCTCCTCGGCCCGGG - Intronic
1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG + Intronic
1163566094 19:18052158-18052180 CCGTGGAGGCGCGTCGCGCATGG + Intergenic
1163633709 19:18429180-18429202 CCGTGCAGGCTCGGCGGGCAAGG - Intronic
1165013277 19:32863913-32863935 CCCTGCAGCCCCCACGGGCCTGG + Intronic
1166102200 19:40577357-40577379 CCGAGCAGGCGTCACGGGCCGGG - Intronic
1168412151 19:56146882-56146904 CCCTGCAGGCGCTGCGGTCCGGG + Exonic
926155028 2:10448692-10448714 CCGTTCAGCTGCCGCGGGCCGGG - Intergenic
926294588 2:11559712-11559734 CCTTGCTGGCGCCTGGGGTCTGG + Intronic
927512140 2:23650471-23650493 CCGAGCAGGCTCCCCGGGCTTGG - Intronic
927567250 2:24123718-24123740 CCGCGCAGGCGCGTCGTGCGCGG - Intronic
927852832 2:26510824-26510846 GCGTGCAGGCCCGTGGGGCCGGG - Intronic
928442306 2:31302627-31302649 CTCTGGAGGCACCTCGGGCCTGG + Intergenic
930209294 2:48617836-48617858 CCGCGCAGGCGCAAAGGGCCAGG + Exonic
932152754 2:69387583-69387605 CAGTGCTGGCGCCTGGGGCCTGG - Intergenic
934857629 2:97739011-97739033 CTGTGCATGCACCTGGGGCCAGG - Intronic
936104826 2:109614818-109614840 CCGATCGCGCGCCTCGGGCCCGG - Exonic
937320870 2:120959972-120959994 CTGTGCAGGCGCAGGGGGCCTGG + Intronic
937325785 2:120988968-120988990 GCGAGTAGGCGCCGCGGGCCAGG - Exonic
944581745 2:201137911-201137933 CTGTGGAGGCTCCTAGGGCCAGG + Intronic
947717776 2:232350532-232350554 TTGTGCAGGATCCTCGGGCCAGG + Intergenic
948933901 2:241150100-241150122 GCGTGGAGGGGCCGCGGGCCAGG - Exonic
1169046129 20:2535903-2535925 CAGTGCAGGCTCCCAGGGCCTGG + Intergenic
1169198296 20:3694909-3694931 CCCTGCAGGAGCCTGGGTCCAGG - Exonic
1169758889 20:9069334-9069356 CCGTGCAGGTGCCGGGTGCCAGG + Intronic
1171041775 20:21770786-21770808 CCCTGCAGGGGCCTGGGCCCTGG + Intergenic
1172095182 20:32457004-32457026 CCGTGCAGGCCCCACGGCCTGGG + Intronic
1174101554 20:48130071-48130093 CCGTGAAGGGGACTCTGGCCAGG + Intergenic
1175878591 20:62243454-62243476 CCGGGCAGGCGCTGCGGGGCAGG - Intronic
1175979073 20:62727998-62728020 CCCTGCAGGCACCGTGGGCCTGG - Intronic
1176130398 20:63494418-63494440 CCGTGCAGGGGCTTTGGGCTGGG - Intronic
1176274409 20:64255676-64255698 CTGCGCATGCGCCGCGGGCCTGG - Intronic
1176547782 21:8208965-8208987 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1176574608 21:8436199-8436221 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1176611221 21:8987491-8987513 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1179658463 21:42860091-42860113 CAGTGCAGGTGCCTTGGGCCAGG - Intronic
1180167524 21:46037735-46037757 CCGTGTGGGCGCCACGTGCCTGG - Intergenic
1180674783 22:17579780-17579802 CCGGGAAGGTGGCTCGGGCCAGG + Exonic
1180782801 22:18530101-18530123 CCGGGCCGGCGCCGCGGGCGCGG + Intronic
1180946265 22:19695424-19695446 CAGTGCAGCCACCTTGGGCCAGG + Intergenic
1181051289 22:20239374-20239396 CCGTGCCGGCTGCTCAGGCCTGG + Intergenic
1181126363 22:20704133-20704155 CCGGGCCGGCGCCGCGGGCGCGG + Intergenic
1181239691 22:21469439-21469461 CCGGGCCGGCGCCGCGGGCGCGG + Intergenic
1181956279 22:26589916-26589938 CCGAGCAGTCGCGCCGGGCCCGG + Intronic
1182082896 22:27542018-27542040 TCGGGCAGGCGTCTGGGGCCGGG - Intergenic
1184017926 22:41800035-41800057 CCCGGCAGGGGCCCCGGGCCCGG + Intergenic
1184238674 22:43200185-43200207 CCGGGCAGGCGCCTCCGTCCCGG + Exonic
1184712734 22:46262796-46262818 CCCTGCTGGGGCCGCGGGCCTGG + Exonic
1185272223 22:49934860-49934882 CCCTGCAGCCTCCTCAGGCCAGG - Intergenic
1185285539 22:49998186-49998208 CTGTGCTGGCGCCCGGGGCCGGG - Exonic
1203252656 22_KI270733v1_random:125250-125272 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1203260712 22_KI270733v1_random:170336-170358 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
950045555 3:9946850-9946872 CAGTTCAGGCGCCTGGGGCTCGG - Exonic
950370745 3:12527965-12527987 CAGTGAAGGAGCCTGGGGCCAGG - Intronic
950509920 3:13420019-13420041 CCGGGCGGGCGCCGTGGGCCGGG - Intronic
951611340 3:24495134-24495156 CGGAGCAGGCGCCCCGGGCCCGG - Intronic
953150451 3:40319747-40319769 CCTTGCATGCTCCTGGGGCCAGG - Intergenic
956604949 3:71064859-71064881 CCGCGCGGGCGCCCCGAGCCCGG - Intronic
962697330 3:137963066-137963088 CCCTGGAGAAGCCTCGGGCCAGG + Intergenic
968457136 4:705664-705686 GGGCGCAGGCGCGTCGGGCCTGG - Intergenic
968653349 4:1768515-1768537 CCCTGCAGGGGCCTAGGGCAGGG + Intergenic
968974019 4:3811749-3811771 CCCTGCAGGCGAGTCAGGCCTGG - Intergenic
968986943 4:3880643-3880665 CGGTGCAGGCGCCTCTGGCAGGG - Intergenic
978760376 4:112350988-112351010 CAGTGCAGGAGCCTGGAGCCAGG + Intronic
984167534 4:176320302-176320324 CCGTGCCGGGGCCGCGGGCAGGG + Intronic
984527608 4:180875716-180875738 GCGTGCAGGCTCCTCAGGCCAGG - Intergenic
990743498 5:58935961-58935983 CAGTGCAAGTGCCTCGGGCTGGG - Intergenic
1000084775 5:157879547-157879569 CCGTTCAGGGGGCTCGGGCATGG - Intergenic
1001596737 5:172903303-172903325 CCCTGCAGGCACCTGGGCCCTGG + Intronic
1002180519 5:177428829-177428851 CCGTCCAGGCGCCTGGGCTCAGG - Intronic
1002696880 5:181098044-181098066 GCGGGCAGGAGCCCCGGGCCGGG - Intergenic
1002697742 5:181101329-181101351 GCGGGCAGGAGCCCCGGGCCGGG + Intergenic
1003175595 6:3750914-3750936 CCGGGCAGGGGGCTAGGGCCGGG + Intronic
1003504103 6:6725602-6725624 CCGTGCAAGCTCCTCGGGACAGG + Intergenic
1007018589 6:38495747-38495769 CCGTGCAGGTGCATCTGGGCGGG + Intronic
1007451272 6:41941602-41941624 CCCGGCACGCGCCCCGGGCCGGG - Exonic
1007745398 6:44040189-44040211 CCGTGCAGAAGCCGAGGGCCTGG - Intergenic
1012399314 6:98831684-98831706 CCCTCCAGGCGCCAGGGGCCCGG - Intergenic
1012598894 6:101070545-101070567 CCGTGCAGGAGCCACGGTGCAGG - Intergenic
1015366386 6:132401576-132401598 CCCTGCAGGCGGCCCGGGGCGGG - Intergenic
1016010655 6:139135150-139135172 CCGCGCGGGCGCCGCGGGCCCGG - Exonic
1016386754 6:143537064-143537086 CGGGGCGGGCGCCTCGGGCTCGG - Intronic
1018975874 6:168565311-168565333 CCCTGCCAGCACCTCGGGCCTGG - Intronic
1019279570 7:193042-193064 CCCTGCACGCGGCCCGGGCCCGG + Exonic
1020383004 7:7566829-7566851 CCCGGGAGGCGCCTCGGGGCGGG - Intergenic
1032002006 7:128271679-128271701 CCGTGCTGGCCCCGCGGGGCTGG + Intergenic
1034383965 7:150722516-150722538 CCAGGCAGGGGCCTCGAGCCAGG + Exonic
1034956517 7:155338642-155338664 CCGTACACGCGCCTCTGTCCCGG - Intergenic
1034956525 7:155338675-155338697 CCCTGCACGCGCCTCTGTCCTGG - Intergenic
1034956547 7:155338774-155338796 CCCTGCACGCGCCTCTGTCCCGG - Intergenic
1037803907 8:22049123-22049145 CCTCGCCTGCGCCTCGGGCCTGG - Intronic
1040538096 8:48327124-48327146 CCTTGCAGGCCTCTCAGGCCTGG - Intergenic
1045359091 8:101415342-101415364 CCATGCAGGTGGCCCGGGCCAGG - Intergenic
1047782774 8:128123393-128123415 CCGTGCAGCCTCCCGGGGCCTGG - Intergenic
1049208186 8:141373057-141373079 CCGGGCAGGCGCCTGGGCCCAGG - Intergenic
1049416918 8:142499554-142499576 CCTTTGAGGCGCCTGGGGCCTGG - Intronic
1049756350 8:144312797-144312819 CCGGGCATGAGCGTCGGGCCTGG + Intronic
1049828543 8:144685538-144685560 CGCTGCAGTCGCCGCGGGCCTGG + Intergenic
1057139685 9:92718905-92718927 CCGGCCACGCGCCTCGGGGCTGG + Exonic
1059268912 9:113060477-113060499 TCCTCCAGGCGCCTCGGGCTGGG + Intergenic
1059270048 9:113065926-113065948 TCCTCCAGGCGCCTCGGGCTGGG + Intergenic
1059271182 9:113071374-113071396 TCCTCCAGGCGCCTCGGGCTGGG + Intergenic
1059272315 9:113076820-113076842 TCCTCCAGGCGCCTCGGGCTGGG + Intergenic
1059273450 9:113082262-113082284 TCCTCCAGGCGCCTCGGGCTGGG + Intergenic
1059274586 9:113087708-113087730 TCCTCCAGGCGCCTCGGGCTGGG + Intergenic
1060811477 9:126613398-126613420 CCGAGCAGGCGCCGCCGCCCGGG + Intergenic
1061196632 9:129110444-129110466 CCGTCCAGGGCCCTCAGGCCCGG + Intronic
1061582286 9:131545590-131545612 CCTTGCAGCCGCCGCGGGCTCGG + Intergenic
1062338416 9:136082634-136082656 CCGTGGAGGCAGCGCGGGCCTGG - Intronic
1062454471 9:136629143-136629165 CAGGGCAGGCCCCCCGGGCCTGG + Intergenic
1203469059 Un_GL000220v1:108401-108423 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1203476880 Un_GL000220v1:152373-152395 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1186496505 X:10015720-10015742 CCGCGCCGCCGCCGCGGGCCCGG + Exonic
1187181463 X:16946993-16947015 CTGTGCCGGCGCCGCGGGCGGGG + Exonic
1187533513 X:20116823-20116845 CCGCGCAGTCCCCTCAGGCCGGG + Exonic
1189274861 X:39778330-39778352 CCGAGCAGGCTCCTGTGGCCAGG - Intergenic
1195247453 X:103007436-103007458 CGGTGCAGGCTCCTCTGACCAGG - Intergenic