ID: 1162914272

View in Genome Browser
Species Human (GRCh38)
Location 19:13865715-13865737
Sequence CCGGAGCCGGGGCCGCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162914255_1162914272 19 Left 1162914255 19:13865673-13865695 CCGGGAGGGTCGGACTCTGCAAA No data
Right 1162914272 19:13865715-13865737 CCGGAGCCGGGGCCGCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162914272 Original CRISPR CCGGAGCCGGGGCCGCCAGG GGG Intronic