ID: 1162914272

View in Genome Browser
Species Human (GRCh38)
Location 19:13865715-13865737
Sequence CCGGAGCCGGGGCCGCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162914255_1162914272 19 Left 1162914255 19:13865673-13865695 CCGGGAGGGTCGGACTCTGCAAA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1162914272 19:13865715-13865737 CCGGAGCCGGGGCCGCCAGGGGG 0: 1
1: 0
2: 2
3: 37
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162914272 Original CRISPR CCGGAGCCGGGGCCGCCAGG GGG Intronic
900298012 1:1961982-1962004 CTGGAGCCTGGGCAGCAAGGGGG + Intronic
900338018 1:2174374-2174396 CAGGTCCCGGGGCCTCCAGGTGG - Intronic
900562170 1:3312549-3312571 CCGGATCCGGGGCCGGCAGGTGG + Intronic
900599566 1:3497244-3497266 CCGGAGCCAGTGAAGCCAGGGGG + Exonic
901035039 1:6331418-6331440 CCGGCGCTGGAGACGCCAGGAGG + Intronic
901303701 1:8217412-8217434 CCGCAGCCGGCGCCTCCACGCGG + Intergenic
901443405 1:9292958-9292980 CCGGGGCCGGGGCCGCGGGGAGG + Exonic
902515206 1:16986314-16986336 CCGGAGGCGGCGCAGGCAGGCGG + Exonic
902548505 1:17205484-17205506 CAGGAGCTGGGGCCCCAAGGAGG - Intronic
903712824 1:25338514-25338536 TCGGAGCCGGGGCCGTCTGACGG + Intronic
904720060 1:32500824-32500846 CCGCCGCCGCCGCCGCCAGGAGG - Intronic
904774987 1:32901131-32901153 CCGGAACCCGAGCCCCCAGGGGG - Intronic
905449429 1:38047062-38047084 CCGGGGGCGCGGCCGCCACGTGG + Intergenic
906791165 1:48659770-48659792 CCGGTGCCAGGGCCTCCATGAGG - Intronic
907069206 1:51519006-51519028 CCGGAGCCGGAGCCCCCCTGCGG - Intronic
907545121 1:55253199-55253221 GCAGAGCCAGGGCCCCCAGGTGG - Intergenic
908355675 1:63323315-63323337 CCGGAGCCGGGGCCGGACCGGGG + Exonic
914005627 1:143729889-143729911 CCGCTGCCGGAGCCGGCAGGGGG + Intergenic
914098093 1:144561135-144561157 CCGCTGCCGGAGCCGGCAGGGGG + Intergenic
914300889 1:146376480-146376502 CCGCTGCCGGAGCCGGCAGGGGG - Intergenic
914827329 1:151145573-151145595 CCGGATCCGGGGCTCCGAGGAGG + Intronic
915334081 1:155130404-155130426 CTGGAGCCGGTGGGGCCAGGGGG + Intronic
915355971 1:155255344-155255366 TAGGATCCGGGGCCGCCTGGTGG + Exonic
916786797 1:168092414-168092436 CTGGAAACGGGGCAGCCAGGTGG + Intronic
917291732 1:173477722-173477744 CCGGAGGCGGGGAGGCCAGGAGG - Intronic
921355568 1:214281456-214281478 CGGGAGCCGGGGGCGCCGAGCGG + Intronic
923698967 1:236281990-236282012 CCGGGGGCGGGGCCGCCTGGGGG - Intergenic
1064443204 10:15371354-15371376 TCGGCGCCGCAGCCGCCAGGTGG - Intergenic
1066065818 10:31760145-31760167 CCGAAGCCCGGGCTGCGAGGCGG - Intergenic
1069403638 10:68075377-68075399 CCGGTGCCGGGGCCGGGAAGTGG - Intergenic
1069639241 10:69944195-69944217 CAGGGGCCTGGGCGGCCAGGAGG + Intronic
1070147541 10:73785816-73785838 CCGGGGCCTGGGCCGCCGGCCGG - Exonic
1072579108 10:96724516-96724538 CCCGAGCAGGGGCCCACAGGTGG - Intergenic
1072861802 10:99013988-99014010 CCTGAGCCAGGGAGGCCAGGCGG - Intronic
1074690764 10:116002151-116002173 TGGGAGCCAGGGCCGGCAGGGGG + Intergenic
1074721885 10:116271662-116271684 GCGGAGCCGCGGCGGGCAGGTGG - Intronic
1075207030 10:120457036-120457058 GCGGAGCCGGGGCCGCCTCAGGG - Exonic
1076374231 10:129972827-129972849 CTGGCGCCGCGGCCGCCTGGGGG + Intergenic
1076673713 10:132136884-132136906 CCTGAGCAGAGGCCGCCAGCCGG + Intronic
1076736664 10:132462103-132462125 CCGGAACCGGGGCGGGCTGGGGG + Intergenic
1076944643 10:133637798-133637820 CCAGCGCCGGGGCCTGCAGGTGG - Intergenic
1077014201 11:392743-392765 CCCGGGCTGGGGCCACCAGGTGG - Intronic
1077095620 11:797861-797883 CCGGAGTCGCGGTGGCCAGGCGG - Exonic
1077100399 11:819910-819932 GCGGGGCCGGGGGCGGCAGGCGG + Intronic
1077107934 11:849942-849964 CCGGAGCAGGCGCCGGCCGGCGG + Intronic
1077330482 11:1981971-1981993 CTGGGGCCGGGGCCCCCAAGGGG + Intronic
1077648810 11:3951123-3951145 ATGGAGCCTGGGCTGCCAGGAGG + Intronic
1078468810 11:11570606-11570628 CCTGAGCTGGGGTGGCCAGGGGG - Intronic
1081705630 11:45180791-45180813 CCCGAGACGGGGCGGCCACGGGG + Intronic
1081860970 11:46333182-46333204 CCCGGGCCGGGGACGCGAGGCGG - Intronic
1083571122 11:63762875-63762897 CCGCAGCCGGGGCCTCCGAGAGG + Exonic
1083618024 11:64035977-64035999 CCGGAGCGGGGGGCGCGCGGCGG - Intronic
1083780280 11:64914047-64914069 CAGGAGACAGGGCGGCCAGGAGG + Intronic
1083843138 11:65315745-65315767 CCGGCTCCGCGGCCGCCAGGTGG - Intronic
1083899782 11:65638092-65638114 CCGGCGCCGGCTCCGCCTGGGGG - Intronic
1084086725 11:66858353-66858375 CCGGAGCCAGCGTGGCCAGGCGG - Exonic
1084197301 11:67530697-67530719 CCGGGGGAGGGGCAGCCAGGAGG + Intergenic
1084426075 11:69085191-69085213 CCGGCTCCTGGCCCGCCAGGTGG + Exonic
1084757993 11:71251495-71251517 CCGGGGCCGGGGCCACCCGGTGG + Intronic
1085022489 11:73218269-73218291 CCGAAGCCGGGCCAGGCAGGGGG - Intergenic
1085044827 11:73346742-73346764 CCGGAGCCCTGGGCGGCAGGAGG + Intronic
1085464702 11:76715900-76715922 GCAGAGCCGGGGCCACCAGCTGG - Intergenic
1202813460 11_KI270721v1_random:37150-37172 CTGGGGCCGGGGCCCCCAAGGGG + Intergenic
1091888126 12:4031420-4031442 CCGGAGGCCGCGCCGCCAGGAGG + Intergenic
1092230647 12:6773759-6773781 GCGGGGCCTGGGCCCCCAGGAGG - Exonic
1094529239 12:31257921-31257943 CCGAAGCCCTGGCCACCAGGTGG - Intergenic
1095875877 12:47079779-47079801 CCAGAGCCGGGGCCGCGGGAGGG + Exonic
1096649417 12:53054523-53054545 GCGGAGGCGAGGCCGCCAGGGGG + Intronic
1096700636 12:53380533-53380555 CCGTGGCCGGGGCGGGCAGGGGG - Intronic
1097830761 12:64222201-64222223 CCGGGACCGGGGCGGCCAGCGGG + Exonic
1099202462 12:79691332-79691354 CCGGAGTCGGAGGCGCCGGGAGG - Intergenic
1100391539 12:94149255-94149277 CCCGGGCCGGGGCCGCGCGGGGG - Exonic
1102902591 12:116649863-116649885 CCAGACCGGGGGCTGCCAGGGGG + Intergenic
1102980394 12:117236646-117236668 CAGAAGCCGGGGCCAGCAGGGGG + Intronic
1103568744 12:121830391-121830413 CCGGAGCCAGGGGCTCCAGGGGG - Exonic
1103909819 12:124345978-124346000 ACTGAGCTGGGGCCGCCTGGGGG + Intronic
1103914488 12:124369449-124369471 CAGGAGCAGGGGTCGCCTGGGGG + Intronic
1104020558 12:124989207-124989229 GCGGAGCCGGGCCGGGCAGGGGG + Intergenic
1105512297 13:21061134-21061156 CCGGAGCCGCCCCCGCCCGGCGG - Intronic
1105538967 13:21298129-21298151 CCGGAGGCGGGGCCGTCACGTGG + Intergenic
1105799279 13:23889422-23889444 CCGGAAGCGGGGCCGTCACGTGG - Intergenic
1105871939 13:24512883-24512905 CCGGAATCGGGTCCGCCAGGTGG + Intergenic
1105950041 13:25222050-25222072 CTGGAGCTGGGGCTGCTAGGAGG + Intergenic
1108095249 13:46894224-46894246 TCAGAGCGGCGGCCGCCAGGGGG + Intronic
1108497618 13:51040837-51040859 CAGGAGCCGGTGTAGCCAGGGGG + Intergenic
1110190840 13:72727462-72727484 CCAGAGCCAAGGCCCCCAGGCGG - Intronic
1112383647 13:98917863-98917885 CTGCAGCTGGTGCCGCCAGGTGG - Intronic
1113962520 13:114133338-114133360 CCGGTGCCGGGGTCTGCAGGGGG - Intergenic
1114452594 14:22836949-22836971 CCGGAGTCGCGCCCGCCGGGAGG + Intronic
1115854066 14:37611103-37611125 CCGGAGCGGGTCCCGCAAGGCGG + Intronic
1116828275 14:49693128-49693150 CTGGAGGCGAGGCCGCCGGGCGG + Exonic
1116973701 14:51094297-51094319 CCTGGGCCGGGGGCACCAGGCGG + Exonic
1117702459 14:58427144-58427166 CAGGAGCCGCGGCCGCCAGATGG + Exonic
1117722105 14:58638151-58638173 CCGCAGCCGGGCCGCCCAGGCGG - Intronic
1119601922 14:75982348-75982370 CCGGTCCCGGGGCCGCCCGCGGG + Intronic
1121412896 14:93760110-93760132 CCACAGCCTGGGCTGCCAGGGGG + Intronic
1122081623 14:99271046-99271068 CAGGCGCCGGGGCCGCCCGCTGG - Intronic
1122691477 14:103533872-103533894 CCTAACACGGGGCCGCCAGGAGG - Intronic
1122736533 14:103847084-103847106 GCGGGGCCGGGGCCGCCTGCGGG - Intronic
1122959385 14:105087550-105087572 CCGGAGCCTGCCCCGCCGGGCGG - Intergenic
1123035232 14:105469279-105469301 CCGGGTCCTGGGCCGCCTGGTGG - Intronic
1123113593 14:105883961-105883983 CTGGAGGCGGGGCTGTCAGGAGG + Intergenic
1123115816 14:105893600-105893622 CTGGAGGCGGGGCTGTCAGGAGG + Intergenic
1123117844 14:105902710-105902732 CTGGAGGCGGGGCTGTCAGGAGG + Intergenic
1123120060 14:105912315-105912337 CTGGAGGCGGGGCTGTCAGGAGG + Intergenic
1202926603 14_KI270724v1_random:31456-31478 CCAGCGCCGGGGCCTGCAGGTGG + Intergenic
1123402797 15:20003901-20003923 CTGGAGGCGGGGCTGTCAGGAGG + Intergenic
1123512134 15:21010555-21010577 CTGGAGGCGGGGCTGTCAGGAGG + Intergenic
1123709888 15:22979958-22979980 CGGGATCCGGGGGCGCGAGGCGG + Intronic
1124341108 15:28889539-28889561 CTGGAGCCAGGGCAGCCTGGAGG - Intronic
1124612194 15:31216135-31216157 CCGGGGCGGGGGCCGCGAGGAGG + Intergenic
1125508661 15:40281619-40281641 CCAGAGCCGGGGCCGCCCTCCGG + Exonic
1128622427 15:69161369-69161391 CTGGGGCCGGGGCCGCCTTGGGG + Intronic
1128751838 15:70155590-70155612 CCTGAGCAAAGGCCGCCAGGTGG + Intergenic
1129467187 15:75730813-75730835 CTGGAGCCCTGGCCTCCAGGAGG + Intergenic
1129720041 15:77872906-77872928 CTGGAGCCCTGGCCTCCAGGAGG - Intergenic
1132029486 15:98428458-98428480 CCCGAGTCGGTGCCCCCAGGCGG - Intergenic
1132618991 16:855539-855561 CCGGAGGAGGAGGCGCCAGGAGG + Intronic
1132735896 16:1385767-1385789 CCGGGGCGGGGGCACCCAGGAGG - Intronic
1133188264 16:4115712-4115734 CCGGAGCCACGGCGGCCACGCGG - Exonic
1133219924 16:4315651-4315673 CCGGGGGCGGGGCCGCGGGGGGG + Intronic
1133316087 16:4884976-4884998 CAGGAGGCGAGGCCCCCAGGTGG - Exonic
1134070322 16:11256273-11256295 CTGGGGGCGGGGCCGGCAGGGGG - Intronic
1135135830 16:19884932-19884954 CCGGGGGCGGGGCCGGCCGGGGG - Intronic
1135884742 16:26295712-26295734 CCAGAGCCAAGGCCGCCTGGGGG - Intergenic
1136556590 16:31010745-31010767 CCCGGGCCGGGGGCGCCTGGGGG + Intergenic
1137426660 16:48385739-48385761 CCGGAGCCGGGGGGGTCACGCGG - Intronic
1138328105 16:56191849-56191871 CCGCAGCCGGAGCCGACAGAGGG - Intronic
1139473946 16:67193175-67193197 CCCCAGCAGGGACCGCCAGGAGG - Intronic
1139594075 16:67948072-67948094 CTTGAACCGGGGCCGCCAGTTGG + Exonic
1140478658 16:75251230-75251252 CGGGCGCGGGGGCCGCCAGCCGG - Intronic
1141665421 16:85463039-85463061 CGGGACCCGGGGCCTCTAGGAGG - Intergenic
1143321207 17:6070404-6070426 GCGGAGCCGGGGCGGGCAGCGGG - Intronic
1143515461 17:7417431-7417453 CCAGAGCCTGAGCCGCCAGGTGG - Exonic
1143750044 17:9021463-9021485 CGGGGGGCGGGGCCGCCGGGCGG - Intergenic
1144909902 17:18672499-18672521 CCGCAGCCGGGGGCGGCTGGGGG - Intronic
1145250480 17:21294405-21294427 GCGGAGCAGGGGCTGCAAGGAGG + Intronic
1145255214 17:21318564-21318586 CTGGAGCCTGAGCCGCCAGGTGG - Intergenic
1146057704 17:29589457-29589479 CCGGAGCCGGGCCGGGCAGCAGG - Exonic
1146283524 17:31559772-31559794 CCTGAGCCGAGGCGGCCCGGGGG + Intergenic
1146329617 17:31916972-31916994 GTGGAGCCGCGGCCGGCAGGAGG - Intergenic
1147148238 17:38498489-38498511 CCTGACCCCGGGTCGCCAGGGGG - Exonic
1147375325 17:40019555-40019577 CCTGCCCCTGGGCCGCCAGGTGG - Exonic
1147772599 17:42878265-42878287 CAGGAGCTCGGGCAGCCAGGTGG + Intergenic
1147954232 17:44123446-44123468 CCGGACCCCGGGACGCGAGGCGG - Intronic
1148438708 17:47700813-47700835 CCAGTGCTGGGGCCTCCAGGGGG + Intronic
1148491235 17:48025176-48025198 CCGGAGTCGGGTCCGCCCTGGGG + Intergenic
1151370783 17:73645036-73645058 CCGGAGCCGGGGCTGCCCGCCGG - Intergenic
1151558725 17:74859990-74860012 CCGGAGCCGCGGACGCCGGCGGG - Intronic
1151696616 17:75721309-75721331 CCGGAGCCGGGTCCGCCCCCCGG - Intronic
1152226455 17:79095068-79095090 ATGGAGCCGGGGCTGCCAGGAGG + Intronic
1152453232 17:80396908-80396930 CCTGAGCAGGGGCAGCCTGGTGG - Exonic
1152581053 17:81165778-81165800 CGAGATCTGGGGCCGCCAGGGGG + Intronic
1152589213 17:81203156-81203178 CCTGAGGTGGGGCCCCCAGGAGG - Intronic
1154367700 18:13726478-13726500 GCGGGGCCGGGGGCGGCAGGGGG - Exonic
1155057872 18:22200819-22200841 CCTGAGCCCACGCCGCCAGGAGG + Exonic
1158658023 18:59358873-59358895 CCGGCGGAGGGGCTGCCAGGAGG + Intronic
1160178361 18:76613895-76613917 CTGGAGGCTGGGCCGCCAAGAGG + Intergenic
1160566203 18:79788128-79788150 TCAGAGCAGGGGCCGCCACGCGG + Intergenic
1160767457 19:814779-814801 CTGGAGCTGGGGTCCCCAGGTGG - Intronic
1160854055 19:1208031-1208053 CCTGGGCAGGGCCCGCCAGGCGG - Intronic
1160970119 19:1764278-1764300 CTGGAGGCTGGGCCGCCATGGGG - Intronic
1161031856 19:2061338-2061360 CCAGAGCCCCGGCCGCCGGGAGG - Intergenic
1161105744 19:2443220-2443242 CCGGGGCCTGGGGCTCCAGGAGG - Intronic
1161264830 19:3359436-3359458 CCGCAGCCGGGGCCGCGGCGCGG + Intergenic
1161317776 19:3626358-3626380 CCGGAGCCGGGTGAGCGAGGCGG - Intronic
1161393525 19:4033225-4033247 CCGGGCCCAGGGCCGCCAGGGGG - Intronic
1161484132 19:4525603-4525625 CCGGAGCAGGGGCGGGCAGCGGG + Intronic
1162416878 19:10543809-10543831 CCCGATCCCGGGTCGCCAGGCGG - Intergenic
1162901044 19:13795669-13795691 GCGGAGCCGGGGCTGCCCCGCGG + Exonic
1162914272 19:13865715-13865737 CCGGAGCCGGGGCCGCCAGGGGG + Intronic
1163282078 19:16324495-16324517 CGGGAGCCCGGGGCGCCCGGGGG + Intergenic
1163714665 19:18866744-18866766 CGGGAGCCGCGGCCACCAGGAGG + Exonic
1163777496 19:19226899-19226921 CCGGAGCCGGGGCTGCAAGGGGG + Exonic
1164547818 19:29183809-29183831 CTAGAGCTGGGGCCTCCAGGTGG - Intergenic
1164989662 19:32674925-32674947 CCGCTCCCGGGTCCGCCAGGTGG - Intronic
1165312826 19:35039324-35039346 CCGGAGCCCGGGCAGGGAGGAGG + Intronic
1165422127 19:35727532-35727554 CCTGAGCGGGGCCCTCCAGGGGG + Exonic
1166853632 19:45771735-45771757 CCGGGGCCGGGGCCGGGATGCGG - Intronic
1166876854 19:45902645-45902667 CCGGAGGCGGGGCCGAAAGAGGG - Intergenic
1167071835 19:47226500-47226522 CCGGAGGAGGGGGCGGCAGGCGG - Intronic
924988239 2:289325-289347 CCCGAGGCGGGGCGGCCAGGAGG + Intergenic
925068860 2:950869-950891 CCCGAGCCGGAGCCGGCAGAGGG + Exonic
925146613 2:1586992-1587014 CAGGAGCCGGGGCCGCAGCGAGG - Intergenic
925610419 2:5696911-5696933 CCGCCGCCGGAGCCCCCAGGAGG - Exonic
926095858 2:10080277-10080299 CCGGGGGCGGGGACGCTAGGGGG + Exonic
929053419 2:37856623-37856645 CTGGAGCCCTGGGCGCCAGGTGG - Intergenic
930667624 2:54115490-54115512 GGGCAGCCGGGGACGCCAGGAGG - Exonic
931321467 2:61177667-61177689 CGGGAGCCGGGGCTGCCCTGGGG + Exonic
934655904 2:96116740-96116762 CCCGAGGCGCGGCCGCCGGGAGG - Intergenic
934706170 2:96483124-96483146 CAGGAGGCGAGGCTGCCAGGTGG - Intergenic
938451451 2:131425030-131425052 CCAGGGCCGGGGCCACCAGGTGG + Intergenic
938477395 2:131628741-131628763 CCTGAGTCAGGGCTGCCAGGGGG + Intergenic
941384936 2:164841376-164841398 TGGGAGCCGGGGCCCGCAGGTGG - Exonic
942314053 2:174682444-174682466 GCGGACCCGGGGCCGCCCCGTGG - Intronic
946415485 2:219537941-219537963 CCCGAGCCGGGGCCGAGTGGAGG + Exonic
946622375 2:221573345-221573367 CCGGGGCCGGAGCAGCCGGGCGG - Intronic
947218159 2:227768057-227768079 CTGGAGCTGGCGCCGCCAGAGGG - Intergenic
947641628 2:231710432-231710454 CCGGGGCTTCGGCCGCCAGGGGG + Intronic
948701072 2:239760738-239760760 CCCGAGCCGGGGACACCAGCAGG + Intergenic
948722563 2:239910859-239910881 GAGGAGCCGGGGCCTCCAGAAGG - Intronic
948802794 2:240440537-240440559 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948802806 2:240440572-240440594 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948802818 2:240440607-240440629 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948802830 2:240440642-240440664 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948802842 2:240440677-240440699 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948802854 2:240440712-240440734 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948802866 2:240440747-240440769 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948802878 2:240440782-240440804 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
1168769730 20:407889-407911 CCGGAGCCGGGGCTGGAGGGCGG - Intronic
1168886857 20:1266285-1266307 CCGGGGCTGGGGCTGCCGGGAGG - Intronic
1169143762 20:3239643-3239665 CAGGAGGCGGGGCAGCCAGCGGG - Intergenic
1170821381 20:19758280-19758302 CCGGAGGCGGGGGCGACCGGTGG - Intergenic
1171781982 20:29427789-29427811 CCAGCGCCGGGGCCTGCAGGTGG - Intergenic
1172284580 20:33731929-33731951 GTTGAGTCGGGGCCGCCAGGGGG - Exonic
1172587044 20:36092466-36092488 CCGGAGCTGGGGCCGCGCGCCGG - Intronic
1173795538 20:45857103-45857125 CCGGAGCCAGGGGCCCCGGGCGG + Intronic
1175517249 20:59577467-59577489 GCGGAGCCGGGGCCGCGGGGAGG - Intergenic
1175870883 20:62208887-62208909 CGGGAGACGGGGCCACCTGGGGG + Intergenic
1175904189 20:62371745-62371767 CCGGGGCAGGGGCATCCAGGTGG - Intergenic
1175994317 20:62805361-62805383 CCTGCGCAGGGGCCGCCAGGAGG - Intronic
1176199489 20:63854091-63854113 CAGGAGCTGGGGCTGCAAGGAGG - Intergenic
1179445283 21:41426475-41426497 CAGGAGCCTGGGCAGCCTGGTGG - Intronic
1180622628 22:17171953-17171975 CCGGAGGCGGCGCCCCCTGGAGG + Intergenic
1180999465 22:19981367-19981389 CCTGAGCCTGGGCCACCAGGTGG - Exonic
1181164545 22:20976359-20976381 ACGGGGCTGGGGCTGCCAGGAGG + Intronic
1182149833 22:28020153-28020175 CCGGAGCCGCAGCCCCCAGGAGG - Intronic
1182419307 22:30241219-30241241 TCAGAGCCAGGGCCGCAAGGTGG + Exonic
1183338927 22:37267301-37267323 CCAGAGCCGAGGCCCACAGGAGG - Intergenic
1183401728 22:37608939-37608961 CCGGAACCGGGGGCACGAGGCGG + Intronic
1183504495 22:38201850-38201872 CCGGGGGCGGGGCTTCCAGGGGG + Intronic
1183895901 22:40968684-40968706 CCGGAGCAGGGGCCTACAGTGGG - Intronic
1184228255 22:43143126-43143148 CCCGGGCCAGGGCAGCCAGGTGG - Exonic
1184229559 22:43151453-43151475 CCAGTGCCCGGGCTGCCAGGCGG + Intergenic
1184468620 22:44683363-44683385 CAGGAGCTGGGGCTGCCAGGTGG - Intronic
1184662284 22:45970898-45970920 CCGCAGCCGGGGCTGCCCGCCGG + Intronic
1185163589 22:49244207-49244229 CCGGAGCCTGGGCCCCGAGCAGG + Intergenic
1185409456 22:50674480-50674502 CCGGGGCCGGGGCCGGCGCGGGG - Intergenic
950458108 3:13104643-13104665 CCGGAGCCAGGGCCACCGGAGGG - Intergenic
953406988 3:42664526-42664548 GCGGAGGCGGGGGCGGCAGGTGG - Exonic
953947602 3:47163440-47163462 CCGGTGCCGGGCCCGGCAAGAGG - Intronic
954277950 3:49554651-49554673 CCGGGGCCGGCGCCGCCGGGCGG - Exonic
957083512 3:75658608-75658630 CCAGCGCCGGGGCCTGCAGGTGG + Intergenic
959849716 3:111071961-111071983 CCGGGGCCGGGGGAGCCGGGGGG + Exonic
960684801 3:120285426-120285448 CCGGAGGCGGGGCCGCCCCAGGG - Intergenic
960702398 3:120451111-120451133 CCGGAGCAGGGGTCGGAAGGAGG - Exonic
961222722 3:125212756-125212778 GCCGAGCCGGGGCAGCCACGTGG - Intronic
962164934 3:133038660-133038682 GCGGAGGCAGGGCTGCCAGGTGG - Intronic
962309186 3:134313432-134313454 CAGGAGCCGGGGCTGCGAGCTGG + Intergenic
966390916 3:179451511-179451533 CCGGAGCCGGGGCGGGGACGTGG + Exonic
966831933 3:184017541-184017563 CCCTGGCCGCGGCCGCCAGGGGG - Intronic
968574186 4:1357342-1357364 CTGGGGCTGGGGCAGCCAGGTGG + Intronic
968727951 4:2256892-2256914 CAGGAGCCGGGGCAGGCACGTGG - Intronic
968815179 4:2818247-2818269 GCGGAGCTGGGGCCGGCGGGAGG + Exonic
968820145 4:2843949-2843971 CCGGAGCCGGAGCCGACGGGCGG + Exonic
969597827 4:8158880-8158902 CGCGGGGCGGGGCCGCCAGGAGG - Intergenic
969873079 4:10116597-10116619 CCGGGGCCGGGGCAGCGCGGCGG + Intronic
977704955 4:100060814-100060836 CCGGAACCTGTGCTGCCAGGTGG + Intergenic
978885404 4:113761642-113761664 CCGGAGCCGCTGCCGCCCGCCGG - Intronic
979122868 4:116926075-116926097 CCGGACGCGGGGCCGCCCTGGGG - Intergenic
979674779 4:123398686-123398708 CAGAAGCCGCGGCCCCCAGGGGG - Intronic
983577037 4:169271091-169271113 CCGGCGCCCGGGGCGCAAGGGGG + Exonic
985448029 4:190038308-190038330 CCAGCGCCGGGGCCTGCAGGTGG - Intergenic
985489588 5:171594-171616 CCGCAGCGGGGGCCACCTGGAGG + Intronic
985629897 5:1008892-1008914 CGGGGGCCGGGGGAGCCAGGGGG - Exonic
985696656 5:1344836-1344858 CCGGGCGCGGGGCCGCCATGTGG - Exonic
986721148 5:10562807-10562829 CCGGGTCGGGGGCCGCCAGCAGG + Intergenic
986728633 5:10618512-10618534 CGGGAGCCCGGGCTGCCCGGCGG - Intronic
987258307 5:16179605-16179627 CCAGAGCCCGGCCCGCCAGCCGG - Exonic
988065261 5:26224097-26224119 CCAGAGCTGGAGCCCCCAGGAGG - Intergenic
988564808 5:32312623-32312645 CGGGCGACGGGGCAGCCAGGCGG - Intronic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
990510841 5:56487874-56487896 CCCGAGCCGGTGGCGCCAGCTGG - Intergenic
992444096 5:76819160-76819182 CCGGCGTCGGGGCTTCCAGGAGG + Exonic
995623878 5:114056119-114056141 CCGAAGCAGGGGCAGCCAGGTGG + Intergenic
998366915 5:141637739-141637761 CCGGTACCGGGTCGGCCAGGTGG + Exonic
1000547598 5:162621942-162621964 CCGGAGCCGGTGGGGCCAGCCGG - Intergenic
1001652954 5:173328321-173328343 TCCGAGCCGCGGCCGCGAGGAGG - Exonic
1002064913 5:176647229-176647251 CCGAAGGCGGGGCTGCGAGGAGG + Intergenic
1002170358 5:177371109-177371131 CCGGGGCCGGGGCCGGGCGGAGG + Intronic
1002186049 5:177455313-177455335 CGTGAGCCGGCGCCTCCAGGCGG - Exonic
1002419637 5:179138903-179138925 CCGGAGCCCTGCCCGCCAGCTGG + Intronic
1002524362 5:179807027-179807049 CCGTCGCCGGCGCCGCGAGGGGG + Intronic
1004615086 6:17281551-17281573 CCGGAGCCCGAGCCGCGGGGCGG + Exonic
1007363132 6:41372832-41372854 CCTGAGCCGGGGCAGCGAAGCGG - Intergenic
1007573757 6:42911581-42911603 CGGGAGCCGGAGCGGACAGGCGG + Intergenic
1009952555 6:70413720-70413742 CGGGAGCCGGGGGAGCCAGAGGG - Intronic
1010044118 6:71420607-71420629 GCGGAGCCCGGCCCGGCAGGAGG + Intergenic
1013273412 6:108561614-108561636 CCGCAGCCGGGGGCGGCTGGGGG + Exonic
1014205528 6:118651619-118651641 CCGGGGCTGGGGCCGCGAGGGGG + Intronic
1015496595 6:133889601-133889623 CCTGAGCGGGGTCAGCCAGGAGG + Exonic
1015965379 6:138692386-138692408 GCCGACCCAGGGCCGCCAGGGGG + Intronic
1017671831 6:156777195-156777217 CCGGGGCCGGGGCGGCTCGGCGG - Intergenic
1017793642 6:157823082-157823104 GCGGCGCGGGGGCGGCCAGGAGG + Intronic
1017793775 6:157823507-157823529 TCGGGGCCGGGGCCGCGGGGAGG + Intronic
1017819141 6:158037247-158037269 CAAGAGCCGGGGCGGTCAGGTGG - Intronic
1017877649 6:158537224-158537246 CCCGAGCGGGGGCGGCGAGGCGG - Intronic
1019410554 7:904829-904851 CAGGAGCCTGGGCGGCCGGGCGG - Intronic
1019504966 7:1386141-1386163 CCCGAGCCGGGGCCGTCAGACGG - Intergenic
1019620098 7:1987683-1987705 GTGGAGCCGGGGCTGCCGGGCGG - Intronic
1023287064 7:38631239-38631261 CTGGGGCCGGGGACGCCAGGCGG - Intronic
1024287751 7:47773979-47774001 CATGAGCCAGGGCTGCCAGGTGG - Intronic
1024639451 7:51317110-51317132 CCGGGGCCGGCGCCTCCTGGCGG + Intergenic
1026470920 7:70693937-70693959 CCGGCGCCGGGGACGAGAGGAGG + Intronic
1027423538 7:78040372-78040394 CACGACCAGGGGCCGCCAGGGGG - Intronic
1029423416 7:100483426-100483448 GAGGCGCTGGGGCCGCCAGGGGG - Intergenic
1031604089 7:123748488-123748510 CCGGGGCCGGGGCTGGCGGGAGG + Intronic
1034254037 7:149714813-149714835 CCGAAGCCGGGGGCTCCGGGCGG + Intronic
1034338975 7:150340513-150340535 CCAGCGCCGGGGCCTGCAGGTGG - Exonic
1034347647 7:150397196-150397218 CTGCAGCCGGGGCCGCCGCGGGG + Exonic
1034963083 7:155374343-155374365 CGGGAGCAGGGGCGGCCCGGCGG + Intergenic
1037336970 8:17801262-17801284 CCGCCTCCGGGGCCGCCAGGGGG + Intergenic
1037787679 8:21912273-21912295 CCGCTGCAGGGGCCGCCAGGAGG + Exonic
1037886779 8:22599696-22599718 CCGGGGCCGGGGCCGGGAGCGGG + Exonic
1038017657 8:23529017-23529039 CGGGAGCGTGGGCAGCCAGGCGG + Exonic
1038828483 8:31032945-31032967 CCGGAGCGGCGGCCGCCAACCGG - Exonic
1039608391 8:38901113-38901135 CGGGCGCCGGGGCCGCGCGGGGG - Intergenic
1039685897 8:39801659-39801681 CCTGAGCCTGAGCCCCCAGGGGG - Intronic
1040055898 8:43056554-43056576 CCCGAGCCGCGGCCGCCGCGGGG - Intronic
1040640945 8:49333884-49333906 CTGGAGCCTGGGCAGCCTGGGGG + Intergenic
1042591491 8:70402768-70402790 CCGGGGCCGGGGGCGGGAGGCGG - Intronic
1045063434 8:98426833-98426855 GCCGAGCCGGGGGCGCAAGGTGG + Intronic
1047259225 8:123241160-123241182 CCGGGGCCGGGGCCCCGCGGAGG + Intronic
1049181616 8:141225916-141225938 CCAGGGCCGGGGCCGCACGGAGG - Intronic
1049405766 8:142451238-142451260 CAGGAGCCGCCGCGGCCAGGAGG - Intronic
1049532245 8:143160351-143160373 CCGGGGCGGGGGCCGCGCGGGGG + Intronic
1049641058 8:143716253-143716275 GCGGAGCCGGGGCCTGCCGGGGG + Exonic
1049718226 8:144103737-144103759 CCGGAGATGGCGCCGCCAGCGGG - Exonic
1049773101 8:144392782-144392804 CCGGGGCTGGAGCCGCCTGGCGG + Exonic
1052851636 9:33381716-33381738 GCGGAGTGGGGGGCGCCAGGGGG - Intergenic
1053072898 9:35111514-35111536 GCGGAGCCGGGGCGGCCCCGGGG - Exonic
1054798540 9:69325087-69325109 CGGGAGGCGGACCCGCCAGGCGG + Intronic
1055611721 9:78031398-78031420 CCAGGGCCGGGGCCACCAGGTGG + Exonic
1055757323 9:79570985-79571007 CTGGGGCCGGGGCCGCGGGGTGG - Intergenic
1056659202 9:88532533-88532555 GGGGAGCCCGGGCCGGCAGGCGG + Intergenic
1057303095 9:93897576-93897598 CCTGAGCCCGGGCCCCCAAGGGG + Intergenic
1058686811 9:107487726-107487748 CAGCAGCCGCAGCCGCCAGGTGG - Exonic
1061366109 9:130172997-130173019 GCGGAGAGGGGGCCGCCAGGGGG - Intronic
1061472172 9:130835339-130835361 GCGGGGCCGGGGGCGCCGGGGGG + Intronic
1061954821 9:133955937-133955959 CCGGAGCGGGGGCCTCCAGCAGG - Intronic
1061959227 9:133979590-133979612 CCGGAGCCACGGCCGCCGGCAGG + Intronic
1061975944 9:134068100-134068122 CCCGCGCCGGGGCCGCCCAGGGG + Intronic
1062542032 9:137045819-137045841 CCGGGGCCGGGATCGCCGGGCGG - Intronic
1203441770 Un_GL000219v1:16014-16036 CCAGCGCCGGGGCCTGCAGGTGG - Intergenic
1203512580 Un_KI270741v1:134923-134945 CCAGCGCCGGGGCCTGCAGGTGG - Intergenic
1186529613 X:10282112-10282134 CAGGAGCTGGGGCAGCCTGGAGG - Intergenic
1187507288 X:19887795-19887817 CCGGGGCCGGGGCCGCGTCGGGG + Intergenic
1188811340 X:34657057-34657079 CCGCAGGCGAGGACGCCAGGCGG + Exonic
1190024824 X:46913085-46913107 ACGGAGGAGGGGGCGCCAGGAGG - Intronic
1190318055 X:49163847-49163869 CCGCAGCTCGCGCCGCCAGGGGG - Exonic
1190745763 X:53321083-53321105 TCGGATCCCGGGCCGCCCGGGGG + Exonic
1190758704 X:53422595-53422617 CCGGCGCCGCGGCCGTCATGGGG - Exonic
1191085816 X:56565443-56565465 CCAGAGCCGGTGGAGCCAGGGGG - Exonic
1195743593 X:108091559-108091581 CCGGAGCCGGCGACGTGAGGCGG - Exonic
1197602113 X:128543272-128543294 CCGGGGCCGGAGCCGCTAGGGGG - Intergenic
1199736883 X:150693582-150693604 CCGAACCCGGGGCCGGCGGGCGG + Exonic