ID: 1162916917

View in Genome Browser
Species Human (GRCh38)
Location 19:13879565-13879587
Sequence GTGTCTACAAAAAATTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4863
Summary {0: 5, 1: 121, 2: 651, 3: 1186, 4: 2900}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162916907_1162916917 19 Left 1162916907 19:13879523-13879545 CCCAAGAGTTTGAGACCAGCCAG 0: 17
1: 908
2: 12239
3: 22737
4: 31501
Right 1162916917 19:13879565-13879587 GTGTCTACAAAAAATTAGCTGGG 0: 5
1: 121
2: 651
3: 1186
4: 2900
1162916908_1162916917 18 Left 1162916908 19:13879524-13879546 CCAAGAGTTTGAGACCAGCCAGG 0: 24
1: 1789
2: 23297
3: 44866
4: 60695
Right 1162916917 19:13879565-13879587 GTGTCTACAAAAAATTAGCTGGG 0: 5
1: 121
2: 651
3: 1186
4: 2900
1162916912_1162916917 4 Left 1162916912 19:13879538-13879560 CCAGCCAGGGCAACATGGTGAAA 0: 85
1: 10311
2: 116413
3: 192002
4: 230276
Right 1162916917 19:13879565-13879587 GTGTCTACAAAAAATTAGCTGGG 0: 5
1: 121
2: 651
3: 1186
4: 2900
1162916913_1162916917 0 Left 1162916913 19:13879542-13879564 CCAGGGCAACATGGTGAAACCCA 0: 277
1: 11529
2: 125439
3: 203811
4: 234802
Right 1162916917 19:13879565-13879587 GTGTCTACAAAAAATTAGCTGGG 0: 5
1: 121
2: 651
3: 1186
4: 2900

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162916917 Original CRISPR GTGTCTACAAAAAATTAGCT GGG Intronic
Too many off-targets to display for this crispr