ID: 1162921588

View in Genome Browser
Species Human (GRCh38)
Location 19:13906372-13906394
Sequence CAGAGCCCGGGGAAGGAGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 787
Summary {0: 1, 1: 0, 2: 4, 3: 73, 4: 709}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162921576_1162921588 30 Left 1162921576 19:13906319-13906341 CCGCGGGGCGCCGACGAGGAGTG 0: 1
1: 0
2: 1
3: 3
4: 47
Right 1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG 0: 1
1: 0
2: 4
3: 73
4: 709
1162921578_1162921588 20 Left 1162921578 19:13906329-13906351 CCGACGAGGAGTGCAGGACTCAG 0: 1
1: 0
2: 1
3: 12
4: 98
Right 1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG 0: 1
1: 0
2: 4
3: 73
4: 709

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162921588 Original CRISPR CAGAGCCCGGGGAAGGAGGC AGG Exonic
900096532 1:942242-942264 CAGACCCCAGGTGAGGAGGCGGG + Exonic
900109840 1:1000714-1000736 CAGAGCCGGGGGAAGGTCGGCGG + Intergenic
900155286 1:1201340-1201362 CGGAGCCCGGGGGAGGCGGGCGG - Intergenic
900240466 1:1615127-1615149 CAGAACCCGGGGCGGGAGGACGG + Intergenic
900477155 1:2881442-2881464 CAGAGCCCATGGAGGCAGGCTGG - Intergenic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
901001120 1:6149212-6149234 CAGAGCCCCGGGCTGGGGGCGGG - Intronic
901312716 1:8282000-8282022 CAGAGCCACGTGGAGGAGGCGGG - Intergenic
901433384 1:9232022-9232044 CAGAACCCCGTGAAGGAAGCCGG - Intergenic
901642724 1:10701223-10701245 CAGGGACCCGGGCAGGAGGCAGG - Intronic
901923661 1:12552811-12552833 CCAAGGCCAGGGAAGGAGGCCGG - Intergenic
902078652 1:13806235-13806257 CAGAGCCCAGGGATGGAGGCGGG - Intronic
902078664 1:13806268-13806290 CAGAGCCCAGGGATGGAGGCGGG - Intronic
902361484 1:15944661-15944683 CAGGGGCCGGGGTAGGAGGCCGG + Intronic
902394783 1:16126678-16126700 CAGACCACGGTGAAGGAGACAGG + Intronic
902517335 1:16996490-16996512 CAGAACCCTGGGGAGGAGGCGGG + Exonic
902535276 1:17116169-17116191 CACAGCCCGTGGATGGAAGCTGG + Intronic
902609392 1:17588289-17588311 CAGGGCTGGGGGAGGGAGGCGGG + Intronic
902620293 1:17646839-17646861 CAGTGGCCGAGGGAGGAGGCTGG + Intronic
902840394 1:19070525-19070547 CAGGGCCCGGAGCAGGAGCCGGG + Intergenic
903087487 1:20875663-20875685 CAGCACTCTGGGAAGGAGGCAGG + Intronic
903286008 1:22277205-22277227 CAGAGGCCGGTGGGGGAGGCTGG + Intergenic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904089156 1:27932452-27932474 CTAAGCCTGGGGAAGCAGGCAGG - Intergenic
904285835 1:29452806-29452828 CAGAGCACGGGGATGCAGGAGGG + Intergenic
904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG + Intergenic
904424622 1:30415453-30415475 CAGAGCCCCCGGGAGGATGCTGG - Intergenic
904644400 1:31955075-31955097 CAGAGGCAGGGGAGGCAGGCAGG + Intergenic
904771935 1:32885790-32885812 CAGAGGCTGGGGAGGGAGGAAGG + Intergenic
904835801 1:33335283-33335305 AACAGCCCTGGGAAGGGGGCGGG - Intronic
905226584 1:36482892-36482914 CAGAGCTCGGGGAGAGAAGCTGG - Exonic
905473033 1:38207347-38207369 CAGTGCCTGAGGCAGGAGGCAGG + Intergenic
905572561 1:39017251-39017273 CAGGGCCTGGTGGAGGAGGCTGG + Intergenic
906155992 1:43614269-43614291 CAGAGCACAGGGCAGCAGGCAGG - Intronic
907091284 1:51728746-51728768 GAGAGGCGGGGGAAGGAGGGAGG - Intronic
907908683 1:58808426-58808448 AAGAGGCAGGGGAAGGAGGGCGG + Intergenic
910207126 1:84759310-84759332 CAGGGCCACGGGAAGGAGGTGGG - Intergenic
912511782 1:110194782-110194804 CAGAGCCTGGGCATGGGGGCAGG - Intronic
913203507 1:116515332-116515354 CAGACCACGGGGGAGGAGGCCGG - Intronic
913240699 1:116826892-116826914 CAGGGCCCGGCCAAGGGGGCTGG - Intergenic
913562395 1:120034909-120034931 CAGAGGCCAGGGAGGCAGGCTGG + Intronic
913635729 1:120758698-120758720 CAGAGGCCAGGGAGGCAGGCTGG - Intergenic
913639145 1:120793769-120793791 CAGAGCTCTGGGAAAGAGACAGG + Intergenic
914241723 1:145857334-145857356 CAGAGTCCAGGGATGGAGGCGGG - Intronic
914279307 1:146156189-146156211 CAGAGCTCTGGGAAAGAGACAGG - Intronic
914282983 1:146194290-146194312 CAGAGGCCAGGGAGGCAGGCTGG + Intronic
914540351 1:148607119-148607141 CAGAGCTCTGGGAAAGAGACAGG - Intronic
914544013 1:148645008-148645030 CAGAGGCCAGGGAGGCAGGCTGG + Intronic
914622611 1:149426002-149426024 CAGAGGCCAGGGAGGCAGGCTGG - Intergenic
914626294 1:149464095-149464117 CAGAGCTCTGGGAAAGAGACAGG + Intergenic
914718293 1:150268937-150268959 CAGACCCCGGGGAAGGGGAAGGG + Exonic
914830878 1:151169959-151169981 CAAAGCCCAAGGAAGGAGGCAGG + Exonic
915021714 1:152786097-152786119 CTCAGCCTGGGGAGGGAGGCAGG + Intronic
915340676 1:155175061-155175083 CAGAGATGGGGGATGGAGGCAGG + Intronic
916074836 1:161194215-161194237 CAGTGCCCTGGGAAGGGGGTTGG + Exonic
916628021 1:166580528-166580550 CAGAGGCCAGGGAAGTGGGCTGG + Intergenic
917188795 1:172391318-172391340 GAAATCCCGGGGAAGGGGGCTGG + Intronic
917975750 1:180236481-180236503 AGGAGCCGGGGGAAGGAGGATGG + Intronic
919724160 1:200871352-200871374 CAGAGCCCAGGGTAGGAAGGTGG - Intergenic
919841323 1:201611287-201611309 AAGAGCTTGGGGAAGGAGGATGG + Intergenic
920181036 1:204131809-204131831 CCTGGCCTGGGGAAGGAGGCGGG - Exonic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920572013 1:207024571-207024593 CAGAGGCGGGGGAGGGAGTCAGG - Intronic
921518527 1:216128908-216128930 CAGAGCCTGGGGAAGGAAATGGG - Intronic
921672972 1:217946731-217946753 AAGAACTCGGGGGAGGAGGCAGG + Intergenic
922730548 1:227946928-227946950 CGGCGCTCGGGGTAGGAGGCTGG + Intronic
922773536 1:228203779-228203801 CAGAGGCTGGGGAGGGAAGCGGG + Exonic
923497775 1:234540177-234540199 CGGAGTCCTGGGAAGGAGCCTGG - Intergenic
924052826 1:240093788-240093810 CAGAGCCCAGGGAGGGCGGGTGG - Intronic
924931903 1:248739620-248739642 CAGTCCCCGAAGAAGGAGGCTGG + Exonic
1062857055 10:784674-784696 CAGACCCCGGGGCGGGAGGTGGG - Intergenic
1062938999 10:1407802-1407824 GAGGGCCTGGGGATGGAGGCCGG - Intronic
1063123130 10:3118681-3118703 CACAGACTGGGGAAGGCGGCCGG + Intronic
1063981215 10:11453325-11453347 AAGAGGCTGGGGCAGGAGGCTGG + Intergenic
1064757582 10:18585634-18585656 CAGAGGCTGGGGGAGGAGGGAGG + Intronic
1065214828 10:23439373-23439395 CCGGGCCCGGGGGAGGGGGCCGG - Intergenic
1066366523 10:34782304-34782326 CAGCGCCCAGTGGAGGAGGCTGG - Intronic
1067415377 10:46098122-46098144 CACCTCCCAGGGAAGGAGGCAGG + Intergenic
1067435418 10:46273199-46273221 CACCTCCCAGGGAAGGAGGCAGG + Intergenic
1067497490 10:46773688-46773710 CAGAGCCCAGGGGAGGATGGGGG - Intergenic
1067523888 10:47027034-47027056 CAGAGCCCTAGGAAGAAGCCAGG + Intergenic
1067581877 10:47451446-47451468 CAGGGCCAGGGCCAGGAGGCGGG + Intergenic
1067582216 10:47452889-47452911 CACCTCCCAGGGAAGGAGGCAGG + Intergenic
1067831398 10:49612969-49612991 CAGAGCCCGGGGATGCCGCCCGG + Intronic
1069212465 10:65779272-65779294 AAGAGCTCAGGGAGGGAGGCTGG + Intergenic
1069504827 10:68988581-68988603 CAGGGGGCGGGGAAGGAGGTGGG + Intergenic
1069510368 10:69037658-69037680 CAGAGCCCGGAGATGCAGGCAGG + Intergenic
1069870030 10:71527443-71527465 CAGGGCCCAGAGGAGGAGGCTGG - Intronic
1070326869 10:75395460-75395482 CAGAGCCCGGCGGAGCAGGAAGG - Intergenic
1070486466 10:76936736-76936758 CAGAGCCCTGGGAAAAAGGCAGG + Intronic
1070788804 10:79177584-79177606 GACATCCCGGGGCAGGAGGCAGG - Intronic
1071104850 10:82082464-82082486 TAGAGCCTGGGAAAGGAGGTGGG + Intronic
1072696765 10:97609630-97609652 TATAGCCAGGGGCAGGAGGCAGG - Intronic
1072750450 10:97975007-97975029 TGGAGCCCGCGGGAGGAGGCCGG + Intronic
1073214316 10:101828252-101828274 CAAAGTCCTGGGAAGGAGGCAGG + Exonic
1073439481 10:103544150-103544172 CAGAGCCAGGGGAGGGAAGGAGG + Intronic
1075084754 10:119407151-119407173 CAGAGCCTGGGGAAGGGGAAGGG - Intronic
1075194851 10:120347698-120347720 CACTGCCAGGGGATGGAGGCGGG - Intergenic
1075257846 10:120939505-120939527 GAGAGCTCAGGGAAGGAGGAAGG - Intergenic
1075261143 10:120964701-120964723 CAGAGCTCAGGGAAGCAGACAGG - Intergenic
1075472579 10:122703994-122704016 CAGAGCCCAGGGATGGCTGCAGG - Intergenic
1075656863 10:124167821-124167843 CAAGGCCCAGGGAAGGAGGGAGG - Intergenic
1075721256 10:124588881-124588903 CAGTGCCCTGGGAATGAGGAAGG + Intronic
1076035576 10:127196419-127196441 CAGAGCCAGGGCCAGGAGGCGGG + Intronic
1076371565 10:129959210-129959232 GGGCGCCCGGGGGAGGAGGCTGG - Intronic
1076628647 10:131839402-131839424 GGGAGCCCTGGGAAGGAAGCAGG - Intergenic
1076677739 10:132156199-132156221 CTGAGCCGAGGGAGGGAGGCGGG - Intronic
1077060787 11:617069-617091 CAGAGCCTCGGGAAGGCGGCGGG + Exonic
1077080035 11:721100-721122 CCGGGCCCTGGGGAGGAGGCAGG - Exonic
1077179487 11:1205908-1205930 CAGAGCCCAGGGGTGGAGCCTGG + Intergenic
1077303989 11:1859740-1859762 CAGAGCCACGGGTAGGGGGCAGG - Intronic
1077333742 11:1994414-1994436 AAGACCCCGGGGAGGGAGCCCGG + Intergenic
1077404130 11:2375243-2375265 CAGAGCCAGGGGAAAGGGGCTGG - Intergenic
1077438955 11:2559407-2559429 TAGAGCCCGGGGCAGGGGGAGGG + Intronic
1077477574 11:2797672-2797694 CGGGGCCCGGGGGAGGAGGAGGG - Intronic
1077540216 11:3143105-3143127 CAGAGCCGGGCAGAGGAGGCAGG + Intronic
1077540230 11:3143155-3143177 CAGAGCCGGGCAGAGGAGGCAGG + Intronic
1077540236 11:3143180-3143202 CAGAGCCGGGCAGAGGAGGCAGG + Intronic
1077896351 11:6456435-6456457 CATCGTCCGGGGAAGGTGGCAGG + Exonic
1078508733 11:11969752-11969774 CAGAGCCCCTGGAAGGGGACTGG - Intronic
1078933175 11:15928840-15928862 GAGAGCCTCGGGAAGGAGTCTGG + Intergenic
1079304759 11:19312174-19312196 CAGAGCCGGGGTAAGGTAGCTGG + Intergenic
1080316121 11:30950694-30950716 CAGAGCCTGGGAAAGGTAGCGGG + Intronic
1080603933 11:33848303-33848325 CAGAGCAGGAGGAAGGTGGCGGG - Intergenic
1080729433 11:34934421-34934443 AAGAGCCCGGGGGAGGAAGGTGG + Intronic
1080836269 11:35943970-35943992 CCGGGCCCGGGGAAGGCGGGAGG + Intronic
1082828833 11:57600351-57600373 CAGGACCTGGGTAAGGAGGCTGG - Exonic
1083174173 11:60938986-60939008 CCCAGCCCGGGGAAGGGGGTTGG + Intronic
1083261876 11:61527587-61527609 CAGAGGCCGAGGAGGGAAGCTGG - Intronic
1083304221 11:61754363-61754385 CAGAGCCCCGGGACAGATGCAGG - Intronic
1083307566 11:61769233-61769255 GAGAGCCAGGGGAAGGGGCCGGG - Intronic
1083327212 11:61878842-61878864 CTGAGCCTGGGGAGAGAGGCAGG + Exonic
1083328120 11:61883944-61883966 CAGTTCCCTGGGAAGCAGGCTGG + Intronic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083618321 11:64036885-64036907 GAGACCCCGGGGAGGAAGGCTGG + Intronic
1083889782 11:65589965-65589987 CCAAGCCCAGGGGAGGAGGCTGG + Exonic
1084084730 11:66849797-66849819 CAGATCCAGGGGAGGGAGGGAGG + Exonic
1084171754 11:67404345-67404367 CAGAGCCAGGGTAAGGGGGCAGG + Exonic
1084548244 11:69825234-69825256 CAGAGCCAGAGGCAGGAAGCTGG - Intergenic
1084764718 11:71300822-71300844 AATAGCCCAGGGAAGGAGGCAGG + Intergenic
1085644625 11:78214961-78214983 CAGCCCCTGGGGAAGGAGGTAGG - Intergenic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1085741642 11:79082467-79082489 CTGAGGCCGTGGAAGGAAGCAGG - Intronic
1086398721 11:86443277-86443299 CCAAGCACGTGGAAGGAGGCTGG - Intronic
1087136415 11:94725150-94725172 CCAAGCTTGGGGAAGGAGGCAGG + Intronic
1088186945 11:107181094-107181116 CAGAGCTAGAGGAAGGAGGAGGG + Intergenic
1088314845 11:108497690-108497712 CAGAGCCGTAGGAAGGAGGAGGG - Intronic
1089151987 11:116371491-116371513 CAGAGGCAGGGGATGGGGGCAGG + Intergenic
1089279974 11:117367090-117367112 CAGAGCCCAGGGCAGGAGACTGG + Intronic
1089604825 11:119635752-119635774 CAGAGCCCGGGGAGGGAAGGCGG + Intronic
1089666263 11:120021938-120021960 CAGAGCCAGCGGAAGAGGGCAGG - Intergenic
1089689860 11:120180584-120180606 CAGAGCTTGGGGCAGGAGCCTGG + Intronic
1090138230 11:124223212-124223234 CAGAGCCAGTGGAAGGTGGGAGG - Intergenic
1090202982 11:124869162-124869184 CAGAGCCTGGGGTAGGCGGGAGG + Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090629457 11:128633493-128633515 CAGAGCCCGGGGAAGCCCCCAGG - Intergenic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1090920662 11:131203588-131203610 CCCAGCCCGGGGAATCAGGCAGG - Intergenic
1090970301 11:131636653-131636675 CAGAGCCCACGGAAGGAGAATGG + Intronic
1202816722 11_KI270721v1_random:49596-49618 AAGACCCCGGGGAGGGAGCCCGG + Intergenic
1091513506 12:1153984-1154006 CAGAGCAGGGGGAGGCAGGCAGG - Intronic
1091558786 12:1594753-1594775 CAGACCCCGGGCGAGCAGGCGGG + Intronic
1091635998 12:2197096-2197118 CACAGCACCTGGAAGGAGGCAGG - Intronic
1091769416 12:3141447-3141469 CAGGGCCCGGGGCAGGAGGAAGG - Intronic
1092123485 12:6060359-6060381 CACACCCAGGGGAAGGAGACCGG + Intronic
1094848536 12:34372119-34372141 CAGGGCCCGTCCAAGGAGGCAGG - Intergenic
1096389468 12:51217706-51217728 CACAGCCCGGGCCAGGGGGCCGG + Intergenic
1096468800 12:51863838-51863860 GAGAGGCCGGGGGAGGAGGGCGG + Intergenic
1096474090 12:51897335-51897357 CAGAGCCTGGGCACGGATGCTGG + Intergenic
1096486519 12:51985694-51985716 CAGAGAGCTGTGAAGGAGGCAGG + Intronic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096660040 12:53118593-53118615 CATAGGCCGGGCAAGGAGACAGG - Intronic
1096694287 12:53338939-53338961 CAGGGCACTGGGAAGGAGACTGG - Intronic
1096792202 12:54052467-54052489 GAGAGCCCAGGGAGGGAGCCGGG - Intronic
1096967426 12:55639346-55639368 CAGAGCCTGGAGAAGGAAGTGGG + Intergenic
1097007778 12:55931521-55931543 TAGAGCCCGGGGCGGGAGGGAGG + Intronic
1097020969 12:56020710-56020732 CAGATCCCGGGCAAAAAGGCTGG - Intronic
1097826274 12:64177500-64177522 AGGAGCCTGGGGAAGGAGCCGGG + Intergenic
1098471619 12:70851433-70851455 CACAGCCTAGGGAAGGAGTCTGG + Intronic
1100001044 12:89835544-89835566 CAGAGCTTGAAGAAGGAGGCAGG + Intergenic
1101605990 12:106247989-106248011 GCGCGGCCGGGGAAGGAGGCCGG + Intronic
1102181708 12:110917595-110917617 CAGAGGCTGGGAAAAGAGGCGGG + Intronic
1102254007 12:111405878-111405900 CGGAGCCCGGCGGGGGAGGCCGG - Intergenic
1102469832 12:113153409-113153431 GTGAGTCCGGGGCAGGAGGCTGG + Intronic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1102983908 12:117263818-117263840 GAGAACCCAGAGAAGGAGGCTGG - Intronic
1103004136 12:117408309-117408331 CAGCTCCTGGGGAAGGAGGGGGG - Intronic
1103562792 12:121800859-121800881 GGGAGCCCGGAGCAGGAGGCGGG - Intronic
1103640424 12:122346937-122346959 AAGAGGCCAGGGAAGAAGGCAGG + Intronic
1104689357 12:130813714-130813736 CAGAGCCCAGGGAGGGTGGCAGG + Intronic
1104736396 12:131138264-131138286 CCGAGCCTGGGGAAGGAGGATGG - Intronic
1104804413 12:131575896-131575918 CTGAGCCCAGGGCAGGTGGCAGG - Intergenic
1105011745 12:132761345-132761367 CAGCCTCCGGGGAAGGCGGCGGG - Intronic
1105884205 13:24628180-24628202 CCCAGCCTGGGGAAGGAGGAGGG - Intergenic
1109789653 13:67230386-67230408 CAGAGCCCGGGGGCGGGGCCTGG - Intronic
1110405067 13:75141838-75141860 CAGAGCTCTGAGAAGTAGGCAGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1113707807 13:112445630-112445652 GAGAGCCCGGGGAGGGAGGGCGG - Intergenic
1113731894 13:112647571-112647593 CCGAGCTTGGGCAAGGAGGCCGG + Exonic
1113762878 13:112862372-112862394 CAGAGCCTGGGGGAGGTGCCGGG + Intronic
1113772149 13:112917185-112917207 CAGTGCCCGGGGGAGGGGTCCGG - Intronic
1113857290 13:113454396-113454418 CAGGCCCCGAGGAAGGAGACGGG - Intergenic
1117315878 14:54569579-54569601 CACACCCCAGTGAAGGAGGCTGG - Intronic
1117410990 14:55450921-55450943 CTGAGCTGGGGGCAGGAGGCAGG + Intronic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1117721989 14:58637754-58637776 AAGAGAGCGGGGGAGGAGGCGGG + Intronic
1117744027 14:58849177-58849199 CAGAGTCTGGGAAATGAGGCTGG - Intergenic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118840332 14:69505104-69505126 CACAGCACAGGGAAGGAGGGAGG + Intronic
1119223369 14:72926606-72926628 CAGAGCTCGGGGTGGGAGACAGG + Intronic
1119318882 14:73717912-73717934 CAGAGCAGAGGCAAGGAGGCTGG + Exonic
1119410238 14:74425931-74425953 CCGAGCCCCGCGGAGGAGGCGGG - Exonic
1119898810 14:78243057-78243079 CAGAGCCCGGAGGAGCAGACAGG - Intronic
1120282271 14:82454454-82454476 CAGAGCCCAGTAATGGAGGCTGG + Intergenic
1120836290 14:89040934-89040956 CTGAGTCCGTGGAAAGAGGCTGG + Intergenic
1121236085 14:92392094-92392116 TAGGGCCCCGGGAAGGAGGAAGG - Intronic
1121316538 14:92964340-92964362 CAGAGCCAGGACAAGGAGCCAGG + Intronic
1122275688 14:100589598-100589620 CAGAGCCTGGGGCATCAGGCAGG + Intergenic
1122388473 14:101364692-101364714 CGGAGCCCAGGGCAGGAGCCAGG - Intergenic
1122429464 14:101630605-101630627 CAGGGGCCCGGGCAGGAGGCAGG - Intergenic
1122447528 14:101780900-101780922 CAGAGTCCAGGGACTGAGGCTGG + Intronic
1122847087 14:104505988-104506010 GTGAGGCTGGGGAAGGAGGCAGG + Intronic
1122863839 14:104594705-104594727 CAGAGTCCAAGGAAGGAGGCAGG - Intronic
1122948007 14:105022002-105022024 CCGAGGCAGGGGCAGGAGGCAGG + Intergenic
1122969821 14:105147979-105148001 CAGACCCGGGGGCAGGGGGCAGG + Intronic
1123087113 14:105721761-105721783 CGGAGCCCTGGGAGGGAGGGAGG + Intergenic
1123154368 14:106210147-106210169 CAGAGCGGGTGGAAGGAGGCTGG - Intergenic
1123994542 15:25709551-25709573 CCGAGCCCAGGGAGGGAGGATGG + Intronic
1124112691 15:26806821-26806843 CAGAGCATGGGGCAGGAGGTGGG + Intronic
1124202182 15:27687923-27687945 CACAGCCTGGGGGAGGAAGCAGG - Intergenic
1124345533 15:28919241-28919263 CCGAGTCAAGGGAAGGAGGCAGG + Intronic
1125549913 15:40537466-40537488 CAGAGCAAGGGGTAGGAGACAGG - Intronic
1125577582 15:40766029-40766051 CAGAGCCCCAGGATGCAGGCAGG - Exonic
1126142813 15:45451488-45451510 CTGAGCCAGGGCCAGGAGGCAGG + Intergenic
1126700457 15:51362138-51362160 GAGAGCTCAGGGAAGGAGACTGG + Intronic
1127207183 15:56733305-56733327 CAGAGCGCGGGGGAGGAGACCGG - Intronic
1127370272 15:58332472-58332494 CAGAGCCCTGTGAAGGAGACAGG + Intronic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1128354920 15:66919358-66919380 CTGAGCAGGGGCAAGGAGGCAGG + Intergenic
1128374467 15:67065517-67065539 CGGGGCGCGGGGGAGGAGGCGGG + Intronic
1128514467 15:68333797-68333819 CAGAGGCTGGGGAGGGAGGCTGG - Intronic
1128720447 15:69943763-69943785 GAGGGCCAGGGGAAGGAGGCTGG + Intergenic
1128743191 15:70097076-70097098 CGCAGCCCAGGGAAGGCGGCCGG - Exonic
1129061975 15:72867446-72867468 CTGAGCCTGGGGAAGGATTCTGG + Intergenic
1129411797 15:75354508-75354530 CAGAGTGCAGGGGAGGAGGCGGG - Intronic
1129712553 15:77827889-77827911 CAGAGGCCCTGGAATGAGGCAGG + Intergenic
1129822957 15:78617129-78617151 CAGATCTCGGGGAAGGAAGCAGG + Exonic
1129824228 15:78624283-78624305 GAGTGCTCGAGGAAGGAGGCAGG + Exonic
1130601766 15:85280254-85280276 CAGAGCCAGAGGAAGGTGGGGGG - Intergenic
1131284853 15:91048376-91048398 CAGAGGCTGAGGAAGGAGGATGG - Intergenic
1132371418 15:101302027-101302049 CCGGGCCCAGGGAAGGAAGCTGG - Intronic
1132566996 16:628120-628142 CAGAGGCCGGGGGAGCAGACAGG + Exonic
1132652851 16:1029304-1029326 CAGTGCCCGCGGAAGGGAGCAGG - Intergenic
1132863114 16:2081225-2081247 CAGAGCCCAGGGACAGAGGGAGG + Intronic
1132980908 16:2738272-2738294 CCCAGCACGGGGATGGAGGCTGG + Intergenic
1134279320 16:12803722-12803744 CAGAGCCAGGGGCAGGACCCTGG - Exonic
1134361834 16:13538317-13538339 AAAAGCCCGAGAAAGGAGGCAGG - Intergenic
1134848318 16:17460051-17460073 CACAACCCAGGGAGGGAGGCAGG + Intronic
1136173005 16:28499521-28499543 TAGAGCCTGGGGCAGGGGGCTGG + Exonic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1137231821 16:46573756-46573778 CACACCCCGGGGCGGGAGGCCGG + Intergenic
1137708057 16:50548768-50548790 CAGACCTCGGGGATGGACGCGGG + Intronic
1137968830 16:52963470-52963492 CAGAGCCAGGGGAATGGGGTGGG - Intergenic
1138361090 16:56427787-56427809 GAGAGGACTGGGAAGGAGGCAGG + Intergenic
1138646954 16:58432495-58432517 CAGAGGCCTGGCAAGGTGGCAGG + Intergenic
1138650163 16:58455719-58455741 CAGAGCCTGGGGCAAGGGGCAGG + Intergenic
1139295545 16:65897346-65897368 CAGAGCCCAGGGTGGGAGACAGG + Intergenic
1139489455 16:67278849-67278871 CAAAGTCCGGTGCAGGAGGCTGG - Exonic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139646982 16:68338575-68338597 CACAGCCTGGGGAAGGCAGCGGG + Intronic
1139948965 16:70660124-70660146 CCGAGCCCGTGGAGTGAGGCGGG - Exonic
1140221620 16:73048156-73048178 CACCGCCCGGGGAAGGGGGGCGG + Exonic
1141431583 16:83973020-83973042 CAAAACCCAGGGAAGGAGGCAGG - Intronic
1141561902 16:84874582-84874604 CAGAGCTCCGGGGAGGAAGCTGG - Intronic
1141576639 16:84968134-84968156 CAGGGGCCGGGGGAGGAGACGGG + Intergenic
1141618240 16:85222060-85222082 CAGGGCCTGGGGAAGGGGACAGG + Intergenic
1141631689 16:85291466-85291488 CGGGGGCCGGGGGAGGAGGCTGG - Intergenic
1141651575 16:85395798-85395820 CAGAGCCTGGGGAGGGTGGGCGG - Intergenic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1141804871 16:86335948-86335970 CAGAGGCCGGGGAGGGTGGGTGG - Intergenic
1141964605 16:87433348-87433370 CAGAGCCCAGAGAGGAAGGCGGG + Intronic
1141976048 16:87517425-87517447 GAGAGGGCGGGGAGGGAGGCTGG - Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142172006 16:88627813-88627835 CAGCTCCCGGGGGAGGAGGGCGG + Intronic
1142211942 16:88812474-88812496 CGGACCCGGGGGAGGGAGGCCGG + Intergenic
1142272219 16:89096053-89096075 CAGCCCTCGGGGAGGGAGGCAGG - Intronic
1142425871 16:90001971-90001993 CAGTGCCCGGGGCAGCAAGCAGG - Intergenic
1142995164 17:3755734-3755756 CAGAGCCCTGGATGGGAGGCAGG + Intronic
1143341965 17:6218660-6218682 CTGAGACCGGGGAAGCAGGCAGG - Intergenic
1143352362 17:6298084-6298106 AAGATCCCTGGGAGGGAGGCTGG - Intergenic
1143497559 17:7321165-7321187 CTGAACTGGGGGAAGGAGGCTGG + Exonic
1143582558 17:7835390-7835412 AAGAGCCCTGGGAGGAAGGCGGG + Intergenic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143926612 17:10376786-10376808 CAGTGCCCAGGAAAGGAGTCAGG + Intergenic
1144500890 17:15786315-15786337 CAGAGCCGGGGGAGGGACGGGGG + Intergenic
1144586691 17:16491770-16491792 CAGGGCCGGCGGGAGGAGGCGGG - Exonic
1144775660 17:17783392-17783414 CAGAGGCCGGGAAACAAGGCGGG + Intronic
1144812199 17:18007635-18007657 CAGACCCCAGGGATGGAGCCAGG - Intronic
1145163052 17:20588977-20588999 CAGAGCCGGGGGAGGGACGGGGG + Intergenic
1145294024 17:21574275-21574297 CAGAGGCCGGGGAAGCAGCGCGG - Intronic
1145369803 17:22298911-22298933 CAGAGTCCGGGGAAGCAGCGCGG + Intergenic
1145978500 17:28997956-28997978 CAGAGCCTGGGGGTGGGGGCAGG - Intronic
1146008360 17:29176606-29176628 CAGAGCGCGGGGAGAGAGCCGGG - Intronic
1147353244 17:39868462-39868484 CAGGGCGAGGCGAAGGAGGCAGG - Intronic
1147583245 17:41638498-41638520 CAGGGCCCTGGGAAGGTGGAGGG - Intergenic
1147743659 17:42682553-42682575 CAGAGGCTGGGGAAGGGGGGAGG + Intronic
1148360865 17:47010862-47010884 CTGAGCCTCGGGAAGGAGGAAGG - Intronic
1148465242 17:47861061-47861083 CAGTGCCCTGGAAAGGGGGCCGG + Intergenic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1148806666 17:50267289-50267311 CAGAGCCTGGGGGAGGAAGCTGG - Intergenic
1148851867 17:50559483-50559505 CAGAACTCGGGGAGGTAGGCGGG + Intergenic
1149649775 17:58269463-58269485 CAGAGACCTGGTGAGGAGGCAGG - Intergenic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1149998249 17:61416240-61416262 CAGTGCCAGGCTAAGGAGGCTGG - Intergenic
1151287051 17:73119701-73119723 TAGAGAACGGGCAAGGAGGCAGG + Intergenic
1151383257 17:73739963-73739985 CAGAGCCAGGGTCAGGAGGGTGG - Intergenic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151490729 17:74431173-74431195 CAGCCCCGGGGGAAGGCGGCCGG + Exonic
1151538040 17:74749574-74749596 CAGACCCGAGGGAAGGGGGCTGG - Intronic
1151557475 17:74853968-74853990 AAAAGCCTGGAGAAGGAGGCGGG - Intronic
1151558908 17:74860600-74860622 CAGAGACCGGCGCAGGCGGCTGG + Intronic
1151668567 17:75559056-75559078 GAGAGCCTGGGCTAGGAGGCAGG - Intronic
1151959548 17:77398446-77398468 CAGCTCCCCGGGAAGGGGGCTGG + Intronic
1151990165 17:77569708-77569730 CAGGGCCCTGGGAAGCAGGCTGG + Intergenic
1152096246 17:78273307-78273329 CAGAGCCTGGGAAAGGGAGCAGG - Intergenic
1152104756 17:78322571-78322593 CTGAGACCAGGGATGGAGGCAGG - Intergenic
1152226158 17:79093873-79093895 CACAGCCTGAGGGAGGAGGCTGG + Intronic
1152238026 17:79148522-79148544 CAGTGGCCGGGGACAGAGGCAGG - Intronic
1152238174 17:79149221-79149243 CAAAGGCCTGGGAAGGTGGCAGG + Intronic
1152339461 17:79716230-79716252 CAGCCCCCGGGAAAGGTGGCTGG - Intergenic
1152390650 17:80001889-80001911 CAGAGCCTGGAGCAGGAGACGGG - Intronic
1152472910 17:80500208-80500230 CAGACCTCGGGGAAGGTTGCGGG - Intergenic
1152524312 17:80878958-80878980 CGGGGCCTGGGGAAGGAGGAGGG - Intronic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1152938486 17:83153831-83153853 CAGACATCCGGGAAGGAGGCAGG - Intergenic
1155053118 18:22165194-22165216 CAGGCCGCGGGGAGGGAGGCCGG + Intergenic
1155174768 18:23292417-23292439 CAGAACCTGAGGGAGGAGGCTGG + Intronic
1155525966 18:26716638-26716660 AAGAGCCCTGGGCAGGAGGCAGG + Intergenic
1155630412 18:27886494-27886516 CAGATCCCAGAGATGGAGGCAGG + Intergenic
1157581178 18:48775110-48775132 TAGAGCCAGGGGGAGGTGGCTGG - Intronic
1157722118 18:49933138-49933160 CTGAGCCTGGGGAAGCAGGTAGG - Intronic
1157768991 18:50327812-50327834 CACAGACCGGGGAAGGCGGGAGG + Intergenic
1158134188 18:54188242-54188264 TATAGCCCGGGGAGGGAGACTGG - Intronic
1158454085 18:57591425-57591447 CAGAGCCCTGGGAAGATGGCAGG + Intergenic
1159637934 18:70827903-70827925 CAGAGACCAGCCAAGGAGGCAGG - Intergenic
1159981741 18:74789633-74789655 CAGAGCCCAGGGAAAGAGCCTGG + Intronic
1160004944 18:75062841-75062863 CAATGCCCAGGGAAGGAGGCTGG - Intronic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160541955 18:79628700-79628722 GAGCACGCGGGGAAGGAGGCTGG - Intergenic
1160665659 19:326846-326868 CAGAGGCTTGTGAAGGAGGCCGG + Intronic
1160701256 19:508498-508520 CTGAGCCCAGGGAAGGTGGTTGG + Intronic
1160717946 19:584886-584908 CAGAGCCCAGGCAGGGAGGTGGG - Intergenic
1160796622 19:948579-948601 CAGAGCCTGGGGCTGCAGGCGGG - Intronic
1160816155 19:1036691-1036713 CAGAGAGCGGGGAGGGAAGCCGG - Intronic
1160861036 19:1237354-1237376 CGGAGGCCGGGGAAGATGGCAGG + Intronic
1160888007 19:1360959-1360981 CAGAGGCGTGGGAGGGAGGCGGG - Exonic
1161065653 19:2236107-2236129 CAGTGCCAGGGGCGGGAGGCCGG - Intronic
1161253288 19:3292972-3292994 CAGAGGGCTTGGAAGGAGGCAGG + Intronic
1161433235 19:4246520-4246542 AGGAGGCTGGGGAAGGAGGCTGG + Intergenic
1161568308 19:5015837-5015859 CAGAGCACGGGGAGAGAGGGGGG - Intronic
1161629343 19:5344463-5344485 CAGAGGGCGGGGAAGGGGGTAGG - Intergenic
1162019777 19:7863107-7863129 CAGGGCCCGGGGCAGGAGCGGGG + Intronic
1162417537 19:10547054-10547076 CAGAGCTCAGGCAAGAAGGCAGG + Exonic
1162525384 19:11203497-11203519 CAGAGCCCAGGCAGGCAGGCTGG - Intronic
1162736790 19:12751556-12751578 CAGAGGTTGGGGGAGGAGGCAGG - Intergenic
1162744327 19:12790303-12790325 CAGCCCCGGGGGAAGGAGCCCGG - Intronic
1162757908 19:12871255-12871277 AAGAGCACGGGAAAGGTGGCGGG + Intronic
1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG + Exonic
1163118318 19:15200930-15200952 CGGAGCCCAGGGAAGGAGGGAGG - Exonic
1163598812 19:18235752-18235774 GGGAGCCCCGGGAAGTAGGCAGG - Intronic
1163625718 19:18388358-18388380 CAGAGCCCGGTGAAGGCGGGAGG - Exonic
1164673177 19:30084703-30084725 CACAGCCCTGGGAAGAAGTCAGG - Intergenic
1164816921 19:31211486-31211508 CTGGACCCGGGGAAGAAGGCAGG + Intergenic
1165075735 19:33278987-33279009 CCCAGCCCAGGGCAGGAGGCAGG + Intergenic
1165369901 19:35398585-35398607 GAGAGCCGTGGGAATGAGGCAGG - Intergenic
1165735697 19:38174078-38174100 CTGAGGCTGGGGAAGGATGCAGG + Intronic
1165737133 19:38183840-38183862 CGGAGCTCGGGCGAGGAGGCTGG + Intronic
1165866923 19:38945283-38945305 CAGAGCCTGGCGGAGGAGCCTGG + Intronic
1165866939 19:38945324-38945346 CAGAGCCTGGGGGAGGAGCCTGG + Intronic
1165866955 19:38945365-38945387 CAGAGCCTGGGGGAGGAGCCTGG + Intronic
1165866997 19:38945470-38945492 CAGAGCCTGGGGGAGGGGCCTGG + Intronic
1165867074 19:38945660-38945682 CAGAGCCTGGGGGAGGGGCCTGG + Intronic
1165867113 19:38945765-38945787 CAGAGCCTGGGGGAGGAGTCTGG + Intronic
1166053964 19:40277672-40277694 GAGAGCCCGAGGAAGTGGGCTGG - Intronic
1166095142 19:40533781-40533803 CAGAGACATGGGAAGGAGTCAGG - Intronic
1166108558 19:40609672-40609694 CGGAGGGCGCGGAAGGAGGCGGG + Intronic
1166777979 19:45323811-45323833 CACCTCCCGGGGAAGGGGGCTGG + Intergenic
1166948271 19:46410464-46410486 CAGAGCCCGGGGCATGAGGATGG + Exonic
1167120341 19:47512975-47512997 CAGAGCCTGGGGACGGTGGTGGG - Intronic
1167276976 19:48544891-48544913 CAGAGACTGGGGAGGGATGCTGG - Intergenic
1167349856 19:48967894-48967916 CAGACCCAGGGGAAGGAGAAGGG - Intergenic
1167428808 19:49442903-49442925 CAGATTCCGGGGGCGGAGGCAGG - Intergenic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1167600267 19:50450947-50450969 CAGCCCCCAGGGAAGGAGGAAGG - Intronic
1167607532 19:50489456-50489478 CAGAGACCGGGGCAGGAAGCAGG + Exonic
1167967220 19:53157791-53157813 CAGAGTCCGGGAGAGGAGGAGGG - Intronic
1168236869 19:55069097-55069119 CAGAGACCTGGGAAGGAGCCAGG + Intronic
1168266591 19:55226964-55226986 CAGAACCGGGGGAAGGCAGCTGG + Exonic
1168272130 19:55255740-55255762 AAGAGCTCCGGGAAGGAGGAGGG - Intronic
1168353870 19:55690575-55690597 GAGAGGCCAGGGGAGGAGGCTGG - Intronic
1168462122 19:56567896-56567918 TAGAGCCCGGGGAAGTTGCCCGG + Exonic
1168599655 19:57707681-57707703 AAGAGCAGGGGGAAGGAGTCAGG - Intronic
924981712 2:228720-228742 CAGACGCAGGGGCAGGAGGCAGG + Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925160188 2:1678064-1678086 CACAGCCCGGGTCAGGAGGCTGG + Intronic
925216104 2:2097084-2097106 AAGAGGCTGGGGAGGGAGGCTGG - Intronic
925221636 2:2146481-2146503 CTGAGCCCAGGAAGGGAGGCAGG - Intronic
925406695 2:3610375-3610397 CAGAGCACCAGGAAGAAGGCGGG - Intronic
926010108 2:9400459-9400481 CAGAGGCCGAGGGAGGAGGGAGG - Intronic
926082011 2:9994936-9994958 AAAAACCAGGGGAAGGAGGCTGG - Intronic
926120165 2:10237473-10237495 CAGAGCCCAGGGCAGGTGCCAGG - Intergenic
926190044 2:10721590-10721612 CAGAGCCCGGGATAAAAGGCGGG + Intergenic
927158518 2:20236326-20236348 CAGTGCCCTGGGATGGAGGCTGG + Intergenic
927557890 2:24049029-24049051 CAGAGCTGGGGGAGGGAGGGAGG - Intronic
927850203 2:26494094-26494116 CAGAGCCCTGGGCTGGAAGCTGG + Intronic
928097524 2:28413565-28413587 GAGAGGCAGGGGAGGGAGGCGGG + Exonic
928260087 2:29758632-29758654 CAGTGCCTGGGGAGGGAGGAGGG - Intronic
928434739 2:31247585-31247607 AAGATACCTGGGAAGGAGGCAGG - Intronic
928606229 2:32947200-32947222 GAGAGCCCGGGAAAGGCGGGAGG - Exonic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
929951370 2:46412082-46412104 GAGAGCCCTGAGAAGGAGGTTGG - Intergenic
932306401 2:70706570-70706592 CAGAGCCTGGGGAGGAGGGCAGG + Intronic
933592926 2:84252433-84252455 CAGAGCCAGAGGAAGGAGCTCGG - Intergenic
934048038 2:88188031-88188053 CAGGGCCTGGGGAAGGATGGAGG - Intergenic
934538958 2:95159228-95159250 CCGAGCCGGGGGTAGGAGGCCGG - Exonic
934780731 2:96968262-96968284 CAGAGCCCCAGGAGTGAGGCCGG - Intronic
934925922 2:98381725-98381747 CTGGGCTGGGGGAAGGAGGCTGG + Intronic
934957340 2:98633380-98633402 CAGATCTCGGGGAGGGAGCCAGG - Intronic
935052411 2:99535038-99535060 CAGAGGTCGGGGAAGGAGAATGG - Intergenic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
935984692 2:108661413-108661435 CACTGCCCAGGGAAGGAGTCAGG - Intronic
936137127 2:109905064-109905086 CACTGCCCAGGGAAGGAGTCAGG - Intergenic
936207570 2:110466421-110466443 CACTGCCCAGGGAAGGAGTCAGG + Intronic
936242658 2:110801222-110801244 GAGAGCACTGGGAAGGAGGAGGG + Intronic
937989867 2:127656328-127656350 CAGAGGCTGGGCCAGGAGGCTGG - Intronic
938301057 2:130213532-130213554 CTGAGCCCGGGGACCGGGGCGGG - Intergenic
938374963 2:130798994-130799016 TAGAGGGCGGGGAAGGGGGCAGG - Intergenic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939498574 2:142952155-142952177 TTGAGCCTGGGGAAGGTGGCGGG - Intronic
940754246 2:157663518-157663540 CAGACTACGGGGAAGGAGACTGG + Intergenic
940833318 2:158492556-158492578 CAAAGCCCGGGCAGGGTGGCAGG - Intronic
940893501 2:159057749-159057771 CAAAGCCTGGTGAAGGAAGCAGG + Intronic
941003168 2:160222047-160222069 CAGAGCCAGGGGGAGTAGGCAGG - Intronic
942059753 2:172217293-172217315 CAGAGCTCAAGGAAGGAGCCAGG - Intergenic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
943772497 2:191733481-191733503 CAGAACCAGTGGAAGGAGGGTGG + Intergenic
944486873 2:200216145-200216167 AAGAGCCCATGGAAGGAGGTTGG - Intergenic
946396848 2:219447695-219447717 CAGGGCTGGGGGGAGGAGGCTGG + Intronic
946717854 2:222571998-222572020 CATCGCCCGGGGAAGAAAGCAGG + Exonic
947119522 2:226800156-226800178 CAGAGCCCCGAGTGGGAGGCCGG + Intergenic
947411277 2:229843114-229843136 CAGAGCCTGGGAAAGGGGGGTGG - Intronic
947731734 2:232435068-232435090 CAGGGCCCAGGGCAGGAGGAAGG - Intergenic
948229954 2:236342284-236342306 CAGAGGCCGGGGCAGGTGGGAGG + Intronic
948232105 2:236356236-236356258 CAGGGCGCAGGGAAGGAGGCTGG - Intronic
948232339 2:236359084-236359106 CAGGGCGCAGGGAAGGAGGCTGG + Intronic
948369086 2:237475808-237475830 TAGACCCAGGGGAAGGATGCAGG + Intergenic
948449603 2:238060977-238060999 CAGAGCGCCGGGGAGGAGGCGGG - Exonic
948457629 2:238114225-238114247 CAGAGCCATGGGGAGGAGGAAGG - Intronic
948535784 2:238645679-238645701 CACAGACCGGGGAAGGGGGATGG - Intergenic
948549945 2:238764623-238764645 CAGAGCCAAGTGAAGGAGGGAGG + Intergenic
948608096 2:239148749-239148771 CGGAGCCCGGGAGAGGAGGCGGG + Intronic
948770132 2:240247635-240247657 CAGTGTCCTGGGAAGCAGGCAGG + Intergenic
948893374 2:240917455-240917477 CAGAGTCCGGGGACGCAAGCAGG + Intergenic
948945017 2:241215047-241215069 CAGAGCCCGGGGCAGACGGCCGG - Intronic
948977738 2:241473767-241473789 GAGAGCCAGGGGATGGGGGCAGG + Intronic
949026758 2:241770013-241770035 CAGAGCCCAGGGACAGAGCCGGG - Intergenic
1168761787 20:354475-354497 AAGAGCCGGGGGTAGGGGGCAGG + Exonic
1168769821 20:408062-408084 CAGAGCCGCGGGAAGGAGCTGGG - Exonic
1168821276 20:775173-775195 CAGGAGCCTGGGAAGGAGGCTGG - Intergenic
1169365173 20:4986220-4986242 CAGAGGCGGGGGCAGGAGGATGG + Intronic
1169578267 20:6990434-6990456 CAGAGCCTCCGGAAGGAGGGTGG + Intergenic
1170429112 20:16260569-16260591 AAGAGGCAGGGGAAGGAAGCAGG + Intergenic
1171101261 20:22385493-22385515 CAGAGCCCCTGGAGGGAGCCTGG + Intergenic
1171251883 20:23654983-23655005 CAGAGCCTGAGGAATGAGGGAGG + Intergenic
1171262720 20:23747973-23747995 CAGAGCCTGGGTGAGGAGGATGG + Intronic
1171345162 20:24460271-24460293 CAGAGCCCAGAGAAGTAAGCAGG - Intergenic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172794455 20:37527480-37527502 CAGAGCCGGGGGCACGGGGCTGG - Intronic
1172889820 20:38256149-38256171 GGGAGCCCGGGGAAAGAGACAGG - Intronic
1173029139 20:39338544-39338566 CAGAGGCTGGAGAAGCAGGCAGG + Intergenic
1173162851 20:40664933-40664955 CAGAGTCTGGGAAGGGAGGCTGG + Intergenic
1173163624 20:40670935-40670957 GAGAGCCAGGGTAAGGAGCCTGG - Intergenic
1173210751 20:41029497-41029519 CAGGGCGCGGGGGAGGCGGCCGG - Intronic
1173516224 20:43667221-43667243 CAGAGCCCGGAGCGGGAGCCGGG - Exonic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174069264 20:47888466-47888488 CAGACCCGGGGGAAGGTGGGTGG - Intergenic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174208835 20:48861016-48861038 CTGGGCCCCAGGAAGGAGGCAGG - Intergenic
1174422030 20:50405512-50405534 CAGTGCCCTGGGAAGCTGGCCGG - Intergenic
1175002922 20:55649360-55649382 CAGAGCCAGTGGAACGAGGGAGG + Intergenic
1175100455 20:56575387-56575409 CTGGGTCCGAGGAAGGAGGCAGG - Intergenic
1175535298 20:59706809-59706831 CAGACCCCAGGGAACCAGGCTGG - Intronic
1175738658 20:61405178-61405200 CGCATCCCGGGGAGGGAGGCAGG - Intronic
1175802371 20:61808134-61808156 CACAGCCTGGGGAAGGCTGCGGG + Intronic
1175924983 20:62467131-62467153 GAGAGCCACGGGAAGGAGGGAGG - Intronic
1175975986 20:62710763-62710785 CAAAGCCCCGAGCAGGAGGCTGG + Intronic
1176217680 20:63956027-63956049 CGGGGCTCGGGGAAGGAGTCCGG - Intronic
1176450597 21:6858431-6858453 CGGTGTCCGGGGAAGGGGGCGGG - Intergenic
1176828767 21:13723449-13723471 CGGTGTCCGGGGAAGGGGGCGGG - Intergenic
1178491947 21:33057995-33058017 GGGAGGCCAGGGAAGGAGGCTGG + Intergenic
1178826721 21:36023697-36023719 CAGAGCTCAGGTACGGAGGCAGG - Intergenic
1178941568 21:36911255-36911277 CAGAGGCCAGGGGAGGGGGCAGG - Intronic
1179213835 21:39349316-39349338 CAGACCCAGGCGAAGGGGGCGGG + Intronic
1179444276 21:41420484-41420506 CAGGGGGCGGGGAAGGGGGCAGG - Intronic
1179655125 21:42839940-42839962 CGAAGCCACGGGAAGGAGGCTGG + Intergenic
1179681092 21:43021913-43021935 CATGGCCCGGGGGAGGAAGCCGG - Intronic
1179788571 21:43743099-43743121 CAGAGCGGGGGGAGGGAGGTGGG - Intronic
1179927960 21:44548637-44548659 CAGAGCCAGGGGACGCTGGCCGG + Intronic
1180001104 21:44995947-44995969 CTGAGGCTGGGAAAGGAGGCAGG - Intergenic
1180161563 21:46000638-46000660 GGGAGGCCGGGGAAGGAGGGCGG + Intronic
1181324256 22:22032624-22032646 GACAGCCCAGGGGAGGAGGCTGG + Intergenic
1181550583 22:23636965-23636987 CAGAGCCCTCAGAAGGAGCCTGG + Intergenic
1181675100 22:24446123-24446145 CTGAGCCGGGGGCAGGACGCAGG + Intergenic
1181801096 22:25348497-25348519 CAGAGCCCTGAGGCGGAGGCAGG - Intergenic
1181814700 22:25429480-25429502 CAGAGCCCTGAGAAGGGGGCAGG - Intergenic
1182696416 22:32202032-32202054 CAGAGCCCCCGGAAGGAGCCCGG - Intronic
1182866184 22:33606577-33606599 GAGAGCACGGGGTAGGGGGCGGG - Intronic
1182888494 22:33796706-33796728 CAGAGCCAGGTGGAGGAGGAGGG + Intronic
1183158650 22:36095188-36095210 CAGAGCTCCGGGAGGGAGACAGG - Intergenic
1183270584 22:36860372-36860394 CAGAGGCTGGGGAAGGCTGCAGG + Intergenic
1183334267 22:37237700-37237722 CCGACCCCGGGGAGGAAGGCAGG - Intronic
1183618519 22:38959428-38959450 CGGAGCAGGGGGAAGGAGGGTGG + Intronic
1184033823 22:41909436-41909458 CAGAGCCAGGGGGAAGTGGCTGG - Intergenic
1184088979 22:42282684-42282706 CAGAGACCTGGGAGGGAGGCCGG + Intronic
1184175918 22:42788623-42788645 CAGTGGCCGGGGAAGTTGGCGGG + Intergenic
1184226807 22:43133481-43133503 TAGAGCCTGGGGAAGGAAGGAGG + Exonic
1184273292 22:43396840-43396862 CAGGGCCTGGGGCAGGAAGCAGG + Intergenic
1184320855 22:43741207-43741229 CAGAGCCCGGAGACCGTGGCTGG - Intronic
1184417186 22:44359206-44359228 CAGAGCCAGGGGGAGGTGGCGGG + Intergenic
1184461276 22:44639558-44639580 GACAGCCCGGGGAAGGTGCCGGG + Intergenic
1184491403 22:44811313-44811335 ACCAGCCCGGGGAAGGAGGCCGG + Intronic
1184535258 22:45082340-45082362 CAGAGCCTGGGAGAGGAGTCAGG + Intergenic
1184621011 22:45676889-45676911 CAGCTACTGGGGAAGGAGGCAGG - Intronic
1184729265 22:46364068-46364090 AAGAGCCCTGGGAGGGAGCCGGG - Exonic
1184765313 22:46569204-46569226 CAGAGGCTGGGGAGGGAGGATGG + Intergenic
1184864032 22:47192678-47192700 GAGGGGCCGGGGAAAGAGGCTGG - Intergenic
1184917936 22:47585979-47586001 CACTCCCAGGGGAAGGAGGCTGG - Intergenic
1184978735 22:48081312-48081334 CAGGGTCCGGGGAAAGATGCAGG + Intergenic
1185309416 22:50145907-50145929 CAGTGCTCAGGGAGGGAGGCAGG + Intronic
950124874 3:10504983-10505005 CAGAGTCCCAGGAAAGAGGCAGG - Intronic
950406779 3:12809955-12809977 CATAATCCTGGGAAGGAGGCCGG + Intronic
950472180 3:13193174-13193196 GAGAGTCCGGGGAATGGGGCAGG - Intergenic
950524996 3:13518342-13518364 GAGGGCCCGAGGAAGGAAGCAGG + Intergenic
950654341 3:14427467-14427489 CAGAGGCCTGGGAAGGAAGGCGG - Intronic
950731024 3:14957886-14957908 CAGAGACCAGGGAAGGAGAGAGG - Intronic
951855173 3:27187909-27187931 AAAAGCCTGGGGAAGTAGGCTGG - Intronic
952591799 3:34963984-34964006 CAGAGACCAGGGAAGGAGTGAGG + Intergenic
952827823 3:37538591-37538613 CAGGGCCCTGGGAAGGTGGGTGG - Intronic
952991488 3:38834773-38834795 CAGAGCCCAGGGATTGAGGAGGG - Intergenic
953226418 3:41025687-41025709 CACAGACTGGGGATGGAGGCAGG + Intergenic
953451262 3:43008375-43008397 CAGAGGACTAGGAAGGAGGCAGG - Intronic
954140713 3:48603776-48603798 CAGAGACAGGGGAAGGGGGTTGG - Intronic
954391024 3:50267947-50267969 CTGACCCCTGGGAAGGAGGGTGG + Intronic
954479862 3:50788779-50788801 CAGAGCGCAGGGAGGGAGGCAGG + Intronic
954630562 3:52045575-52045597 GACAGCCCTGGGAAGGGGGCTGG + Intergenic
954715289 3:52523807-52523829 GTGAGCCCGGGGAAGGTGGTGGG + Intronic
955687484 3:61561798-61561820 CAGGGCCCCGGGAAGGAAGGAGG - Intronic
956097471 3:65732473-65732495 GAGAGTCTGGGGAAGGATGCTGG - Intronic
956364386 3:68484239-68484261 CTGAGCCCTGGAAAGGTGGCTGG - Intronic
957257524 3:77857306-77857328 CAGAGGCTGGGGAAGGATGGAGG + Intergenic
957311558 3:78526157-78526179 CAGAGGCTGGGGAAGGAGAGGGG - Intergenic
961175776 3:124834056-124834078 CAGATTCCGGGGGAGGAAGCAGG + Intronic
961206527 3:125086812-125086834 CAGGGCCCAGGGATGGAGGCTGG - Intronic
962381803 3:134904103-134904125 CCCAGCCCTGGAAAGGAGGCTGG + Intronic
962462760 3:135629914-135629936 CAGAGAACGGGGAGGGAGGAAGG - Intergenic
962992726 3:140593618-140593640 AAGAGCCCTGGGAAGGAGCTGGG - Intergenic
963038675 3:141052773-141052795 CAGGGCTCTGGGAAGGAGGGAGG + Intronic
963138560 3:141929586-141929608 CAGAGCCCGCGTAAGGAGGGAGG + Intergenic
963858110 3:150277392-150277414 CTGACCCTGGGGAAGGAAGCAGG - Intergenic
964435196 3:156643919-156643941 CAGAGGCAGGGGAATGAGGAAGG - Intergenic
965554123 3:170002116-170002138 CAGAATCCGGGGAAGGAGCAAGG + Intergenic
967125083 3:186416027-186416049 CAGGGACCTGGGAAAGAGGCTGG - Intergenic
967721458 3:192820635-192820657 GAGAGCCCGGGGCGGGACGCCGG - Intronic
967947879 3:194818509-194818531 CAGAGCCCGAGGGAAGAAGCTGG - Intergenic
968131094 3:196193261-196193283 CATAGCCCGATAAAGGAGGCAGG - Intergenic
968188977 3:196653652-196653674 CGGAGCTCGGGGAGCGAGGCGGG + Intronic
968205329 3:196794643-196794665 CAGAGGCAGAGGAGGGAGGCGGG + Intronic
968393599 4:213030-213052 CACAGCCCGGGGAAGGTGCGGGG - Intergenic
968419708 4:473738-473760 CACAGCCCGGGGAAGGTGCAGGG + Intronic
968844030 4:3029809-3029831 AGGAGCATGGGGAAGGAGGCAGG - Intronic
969054510 4:4393287-4393309 CAGAGGTCGGGGACAGAGGCTGG - Intronic
969333210 4:6491964-6491986 CAGAGCCAGTGGATGGAGCCCGG - Intronic
969681231 4:8644594-8644616 CAGAGCCATGGGAGGGAGCCTGG - Intergenic
969725947 4:8918123-8918145 CAGTGCCCAGAGAAGCAGGCAGG + Intergenic
970158790 4:13168593-13168615 CCCAGCCCGGTGAATGAGGCAGG - Intergenic
971170849 4:24231178-24231200 AAGAGACCGGGGAGGTAGGCAGG - Intergenic
972346390 4:38196063-38196085 CACTGCCCCGGGAATGAGGCTGG - Intergenic
974137995 4:57843972-57843994 CAAAGCACGTGGAAAGAGGCAGG - Intergenic
978896902 4:113899732-113899754 TAGAGCCCTGGGCAGGTGGCAGG + Intergenic
980554981 4:134391954-134391976 CAGAGCCTTTGGAAGGAGGATGG + Intergenic
980613303 4:135185401-135185423 CATAGGCAGGGGAAGGAGCCTGG - Intergenic
981724699 4:147834797-147834819 CTGACCCAGGGGAAGGAGACAGG - Intronic
982029098 4:151281231-151281253 GAGAGCCTGGGGAATGAGACTGG + Intronic
983464004 4:168063715-168063737 CAAAGGCCGGGGTAGGAGGAGGG + Intergenic
983649928 4:170027282-170027304 AAAAGCCGGGGGAAGGAGCCTGG - Intronic
984206389 4:176792508-176792530 CAGTGCCGGGGAAAGGCGGCGGG + Exonic
984268914 4:177526747-177526769 CAGAGCCCGTGGAAGGAAAGAGG + Intergenic
984999438 4:185469953-185469975 CAGAGCACGGGGCAGGAGAAGGG - Intronic
985068309 4:186144611-186144633 CAGAGACCCGGGAAGGAGTAGGG + Intronic
985558810 5:571116-571138 CCCAGCCTGGGGCAGGAGGCCGG + Intergenic
985622393 5:962453-962475 CAGATGCCAGGGAAGGAGCCTGG + Intergenic
985720385 5:1485752-1485774 CACAGCCCGTGCAGGGAGGCCGG + Intronic
985774115 5:1831780-1831802 AGGAGCCGGGGGAAGGGGGCTGG - Intergenic
986299343 5:6466062-6466084 CAGGGCCCTGGGAGGGTGGCAGG - Intronic
986679799 5:10222337-10222359 AAGAGGCGGGGGTAGGAGGCAGG + Intergenic
986773496 5:10994333-10994355 CGGGGGCCGGGGAAGGAGGAGGG + Intronic
987027205 5:13939588-13939610 GAGAGGCCGGGAAAGGAGACGGG - Intronic
987033208 5:13994736-13994758 CAGAGCCAAGGGGAAGAGGCGGG - Intergenic
990513870 5:56514508-56514530 CAGAGACAGGGGAAGGTGCCAGG - Intronic
991968627 5:72116498-72116520 CATAGCCCCAGGAAGGTGGCTGG - Intronic
992228376 5:74640584-74640606 CAGGCGCCGCGGAAGGAGGCGGG + Exonic
992365138 5:76083275-76083297 CAGCACCAGGGGGAGGAGGCAGG + Exonic
992528034 5:77630388-77630410 CTGGGGCCGGGGAGGGAGGCGGG + Exonic
993094999 5:83471518-83471540 GAGTGCCTGGGGAGGGAGGCAGG + Exonic
995224820 5:109690198-109690220 CCGACCCCGGGGAGGGCGGCAGG + Exonic
995512054 5:112920075-112920097 CAGAGCCCGGGGTAGGCCTCAGG + Intronic
997976765 5:138445613-138445635 CAGAGCTTGGGGAAACAGGCAGG + Intronic
998098917 5:139415670-139415692 CCGAGCCCTGGGCAGGATGCAGG - Intronic
998142861 5:139709783-139709805 CAGAGCCGGGGCGTGGAGGCGGG - Intergenic
998148484 5:139744062-139744084 CAGAGCCAGGAGGAGAAGGCAGG - Intergenic
998159943 5:139807783-139807805 AAGAGCCTGGGGAGGGAGGCGGG - Intronic
998269218 5:140691591-140691613 AAAAGGCCTGGGAAGGAGGCGGG - Exonic
998350353 5:141496348-141496370 CAGAGCCCAGGGAGAGAAGCAGG + Intronic
999244923 5:150148998-150149020 AGGAGGCCAGGGAAGGAGGCAGG + Intronic
999325171 5:150639311-150639333 GAAACCCAGGGGAAGGAGGCTGG - Intronic
999373334 5:151069425-151069447 AACAGCCCTGGGAAGAAGGCAGG + Intronic
999586354 5:153093824-153093846 AAGAGGCTGTGGAAGGAGGCTGG - Intergenic
1001289306 5:170445217-170445239 CAGAGCCCCGTTAAGGGGGCAGG + Intronic
1001484075 5:172107067-172107089 CAGAGTCCTGGGGAGGGGGCGGG + Intronic
1001835355 5:174826656-174826678 CAGGGCCCGGGTGAGGAGGGAGG + Intergenic
1002600884 5:180353379-180353401 GAGAGGGCGGGGAAGGGGGCGGG + Exonic
1002764631 6:228295-228317 CAGAGCACGAGGAGGGAGGGAGG + Intergenic
1003117984 6:3295907-3295929 CAGAGTCCCAGGCAGGAGGCTGG - Intronic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005293683 6:24403069-24403091 CATCGCGCGGGGCAGGAGGCAGG - Exonic
1006171915 6:32097943-32097965 CACAGCCAGTGGAAGGGGGCAGG + Intronic
1006304503 6:33211223-33211245 GAGAGCCCGGGGAGGGAGAAGGG + Exonic
1006370598 6:33641525-33641547 CAGAGCCCCGTGATGGAAGCAGG - Intronic
1007479929 6:42142840-42142862 CCTAGTCCGGGAAAGGAGGCGGG + Intergenic
1007665912 6:43512868-43512890 CATAGCCCTGGGAAGGAGGATGG + Exonic
1007727928 6:43927889-43927911 CAGAGCCCGGTGAAGCAGAGGGG + Intergenic
1007775391 6:44222039-44222061 CAGAGACCAGGAAAGGAGGGTGG + Intronic
1007801841 6:44401185-44401207 CAGAGCCCTGGGGAAGAAGCAGG - Intronic
1008022852 6:46600526-46600548 CAGAGGCTGGGGAATGGGGCTGG - Intronic
1008045739 6:46849588-46849610 CAGAGCCAAGTGAAGGATGCCGG - Intergenic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1010192489 6:73208757-73208779 CCCAGCCCAGGGAAGGAGCCAGG - Intergenic
1010194146 6:73223439-73223461 CCCAGCCCAGGGAAGGAGCCAGG - Intronic
1012399866 6:98834404-98834426 CCGAGCCCGGGGGAGGGGGAGGG + Intergenic
1015190662 6:130468233-130468255 CAGAGGGCCTGGAAGGAGGCTGG - Intergenic
1015708197 6:136110926-136110948 CAGGGCCAGGGAAATGAGGCTGG - Intronic
1016051776 6:139537472-139537494 CACAGCCCAGGGCAGGAGACAGG - Intergenic
1016598511 6:145828614-145828636 CAGAGAACGGGGAAGGAAGAGGG + Intergenic
1016648632 6:146438845-146438867 CAGAGCCCAGGGAAGAATGATGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016915636 6:149241971-149241993 CAGAGCCTGGGGAAGGCAGTGGG - Intronic
1018420913 6:163640668-163640690 CAGAGGCTGGGGCAGCAGGCAGG - Intergenic
1018890066 6:167976858-167976880 AAGACCCAGGGGCAGGAGGCCGG - Intergenic
1018916654 6:168136541-168136563 CAGAGCATGGGGAAGGTTGCAGG + Intergenic
1019009018 6:168826285-168826307 CAGAGCGCAGGGAGGGAGACGGG + Intergenic
1019137781 6:169922114-169922136 GAGAGCCCTGTGAAGGAGGAAGG + Intergenic
1019281959 7:205101-205123 CAGGACCCTGGAAAGGAGGCGGG + Intronic
1019297466 7:285781-285803 CAGACCCCGAGGACTGAGGCGGG - Intergenic
1019528512 7:1492315-1492337 GCATGCCCGGGGAAGGAGGCTGG + Intronic
1019710755 7:2517165-2517187 CTGAGCCTGGGGAAGCGGGCGGG + Intronic
1020089774 7:5332653-5332675 CTGAGCCCGCGCAAGGACGCCGG - Exonic
1021444595 7:20718603-20718625 CAGAGCCCTGGGGGGGAGGGAGG + Intronic
1021819272 7:24480179-24480201 CAGAGCAGGGGGAAATAGGCAGG - Intergenic
1023830997 7:44039004-44039026 GAGAGCCCAGGGAATGAGGGCGG + Intergenic
1024639839 7:51319444-51319466 CAGAGCCTGGGGGGGCAGGCGGG + Intergenic
1025248800 7:57337932-57337954 CAGGGCCCTGGGAAGCTGGCTGG + Intergenic
1026360945 7:69600029-69600051 CGGAGCGCGGCGAGGGAGGCAGG - Intronic
1026568362 7:71508680-71508702 CACAGCCCGGGCATGAAGGCTGG - Intronic
1026600522 7:71773759-71773781 GAGAACCAGGGGAAGGAGGATGG + Intergenic
1026928432 7:74209879-74209901 GGGAGACGGGGGAAGGAGGCGGG - Exonic
1027266626 7:76498351-76498373 CAGAGCCCTGGGCTGGGGGCAGG - Intronic
1027318007 7:76996469-76996491 CAGAGCCCTGGGCTGGGGGCAGG - Intergenic
1029123322 7:98282090-98282112 TAGAGCCCCGGGGGGGAGGCTGG - Intronic
1029206018 7:98869793-98869815 CGGGGCCCAGGGCAGGAGGCAGG + Exonic
1029211876 7:98916030-98916052 CAGGGCCAGGGGAGGGGGGCAGG - Intronic
1029457562 7:100678886-100678908 CGTGGCCCGGGGAAGGGGGCTGG - Exonic
1029594931 7:101532662-101532684 CAGAGTCTGGGGAAGGAGTTGGG - Intronic
1029926938 7:104328533-104328555 CGGAGCCCGGGCCAGGAGGGAGG + Intergenic
1031264993 7:119570346-119570368 CAGAGCACGGGCTAGCAGGCTGG - Intergenic
1033137741 7:138798709-138798731 CAGTGCCCGGGGAGGCAGGAGGG - Intronic
1033535478 7:142308276-142308298 CAGATCCCCGGGAAGGAGCAGGG + Intergenic
1033673905 7:143519220-143519242 CAGATCCGGTGGAAGGAGGGTGG + Intergenic
1033824099 7:145168645-145168667 CAGATCCTGGTGAACGAGGCGGG - Intergenic
1034260565 7:149752817-149752839 GGGAGGCCGGGGCAGGAGGCAGG + Intergenic
1034427439 7:151021456-151021478 TAGAGCCCGGGGCAGGGGGTGGG + Intronic
1034899208 7:154897142-154897164 CTGAGGCCAGGGAAGGAGGGAGG + Intergenic
1034957418 7:155343726-155343748 CAGAGGCCAGGGATGCAGGCAGG - Intergenic
1034974822 7:155441937-155441959 CAGAGCCCTGGGAGGGGGGAGGG - Intergenic
1035427226 7:158787126-158787148 AGGAGCCCAGGGAAGGAGGAAGG + Intronic
1035460283 7:159034402-159034424 CAGTTCCCAGGGAAGGAGGGAGG - Intronic
1035479208 7:159168658-159168680 CAGGGGCTGGGGAAGGAGGAAGG + Intergenic
1035911584 8:3572281-3572303 CAGAGCCTGGGGCAGAAAGCAGG + Intronic
1036442963 8:8797561-8797583 CACTGCCCGGGGATGGGGGCAGG + Intronic
1036708158 8:11060137-11060159 CAGAGCTTGGGGAGGGTGGCAGG + Intronic
1037103018 8:15071496-15071518 CATAGCCCTGTGAAGTAGGCAGG - Intronic
1037308463 8:17530113-17530135 TATAGCACGGGGTAGGAGGCAGG - Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037917547 8:22781696-22781718 CAGAGGCCAGGCAAGGAGTCTGG - Intronic
1038176422 8:25185028-25185050 CAGAGCCCGGCGGAGGACCCTGG + Intronic
1039970182 8:42315515-42315537 CAGGGCCAGGGGAAGGAGTTTGG + Intronic
1040435174 8:47383173-47383195 CAGAGCACCTGGCAGGAGGCTGG - Intronic
1040568974 8:48591629-48591651 CAAAGTCCAGGGAAGGAGACTGG + Intergenic
1040740726 8:50571307-50571329 TTGAGCCCGGGACAGGAGGCAGG - Intronic
1041215529 8:55596382-55596404 CAGGGCAGGAGGAAGGAGGCAGG - Intergenic
1042182451 8:66105167-66105189 CAGAGCCCTGGGAATGAGATGGG + Intergenic
1042961065 8:74304090-74304112 CATAGCCTGGGGCTGGAGGCAGG - Intronic
1044731023 8:95228864-95228886 CAGAGCAGGTGGAAGAAGGCTGG - Intergenic
1044938425 8:97315655-97315677 AAGAGCCCTGGGTAGGAGTCAGG - Intergenic
1045367880 8:101493436-101493458 CGGACCCGGGGGAGGGAGGCGGG - Intronic
1045640172 8:104241074-104241096 CAGAGCACAGTGAAGGAGTCAGG - Intronic
1047499299 8:125429895-125429917 AAGGGCCCGGGGAAGTGGGCGGG - Intergenic
1048214326 8:132481105-132481127 CCCACCCCGGGGAAGGAGGGAGG - Intergenic
1048382039 8:133873966-133873988 CAGAGCCTCTGCAAGGAGGCCGG + Intergenic
1048898210 8:139013691-139013713 AGGAGCCTGGGGAAGGAGCCAGG + Intergenic
1049242415 8:141544770-141544792 CAGGGCCTGGGTAGGGAGGCAGG - Intergenic
1049424548 8:142532291-142532313 CACAGCCCCGGGAAGCAGGTTGG + Intronic
1049488439 8:142878548-142878570 GACAGTCCGGGGCAGGAGGCAGG - Intronic
1049493335 8:142916568-142916590 GACAGTCCGGGGCAGGAGGCAGG - Intronic
1049526547 8:143129752-143129774 CAGGGCTGGGGGAAGGAGGAGGG + Intergenic
1049562225 8:143317541-143317563 CAGAGTCCTGGGGAGGAGGAGGG - Intronic
1049585575 8:143431046-143431068 GAGAGTCCGGGGAAGCAGACGGG + Intergenic
1049613977 8:143568360-143568382 AAGAGCCCAGGGCAGGAGACTGG + Intronic
1049686947 8:143942820-143942842 CAGGGCCCAGGGAGGAAGGCAGG + Intronic
1050537704 9:6645155-6645177 CAGAGCTCAGGGTAGGAGCCGGG + Intronic
1050537715 9:6645190-6645212 CAGAGCCCGGGCAGGGCGGAGGG + Intronic
1051594989 9:18816142-18816164 CAGAGACTGGGGAAGGGAGCGGG - Intronic
1052834881 9:33242850-33242872 CAGAGCACTGGGATGGGGGCAGG - Intronic
1053054264 9:34984906-34984928 CAGAGTCAGAGGAGGGAGGCAGG + Intergenic
1053402750 9:37841145-37841167 CAGATCCAGGGGCAGGAGGAAGG + Intronic
1053651834 9:40177120-40177142 CAGAGCCAAGTGAAGGATGCCGG + Intergenic
1053902226 9:42806433-42806455 CAGAGCCATGTGAAGGATGCCGG + Intergenic
1054532751 9:66199087-66199109 CAGAGCCATGTGAAGGATGCCGG - Intergenic
1055505818 9:76948051-76948073 CAGAGGCTGGGGAAGGAGGGTGG - Intergenic
1056899614 9:90585352-90585374 AGGAGCCCCAGGAAGGAGGCAGG + Intergenic
1056917536 9:90758253-90758275 GAGGGCCCGGAGAAGGAGGAAGG - Intergenic
1058386738 9:104445130-104445152 CAAAGTCTGGGTAAGGAGGCAGG + Intergenic
1058972852 9:110098923-110098945 CAGAGCTGGGGGAAAGAGGAAGG - Intronic
1059115867 9:111599619-111599641 CACTGCCTGGGGAAGGCGGCTGG + Exonic
1059440897 9:114306239-114306261 CAGAGCCCCGTGAATGAGGTAGG - Intronic
1059451827 9:114376020-114376042 GAGAGCCCTGGGATAGAGGCTGG - Intronic
1059470014 9:114497865-114497887 CAGCCACCTGGGAAGGAGGCAGG + Intronic
1059944778 9:119398392-119398414 AAGAGCCCTGAGCAGGAGGCAGG + Intergenic
1059994841 9:119898711-119898733 GAGAGCCCTGGGAAACAGGCTGG + Intergenic
1060137142 9:121168415-121168437 CAGAGCCCAGGAGAGGAGGCAGG + Intronic
1060149003 9:121275428-121275450 AAGAGCCCTGGAAAGGAAGCAGG + Intronic
1060414483 9:123420851-123420873 CAGAGGCGGGGGAGGGAGGAGGG + Intronic
1060695657 9:125707049-125707071 CAGAGCTCGGGGCAGGGGCCGGG - Exonic
1060757835 9:126225848-126225870 CAGAGCCCAGGCAAGGAGAGAGG + Intergenic
1061005768 9:127927827-127927849 CACAGGTCGGGGAAGGGGGCCGG - Intronic
1061208424 9:129177346-129177368 TAGAAGCCGGGGGAGGAGGCGGG + Exonic
1061291837 9:129654898-129654920 TAGGGCCCGGGGAGGGAGGAAGG + Intergenic
1061309808 9:129754826-129754848 CAGAACCCGGGGAAGCGGGCAGG - Intergenic
1061348226 9:130043299-130043321 GGGAGCCCGGGGGAGGGGGCCGG - Intergenic
1061540952 9:131277631-131277653 CAGTGCCCGGGGAAGGGGGTGGG - Intergenic
1061543573 9:131290936-131290958 CAGACCCTGGGGAAGAAGCCTGG - Intronic
1062004488 9:134232329-134232351 CAGGGCCCGGGGGAGCAGGAGGG - Intergenic
1062452562 9:136621713-136621735 CAGAGCCAGGGTGAAGAGGCAGG + Intergenic
1062457097 9:136644995-136645017 CAGAGCCCTGGGAAAGGGTCAGG - Intergenic
1062555468 9:137111822-137111844 CAGAGCTCGGGGCAGAAAGCAGG + Intronic
1203518585 Un_GL000213v1:26086-26108 CGGTGTCCGGGGAAGGGGGCGGG + Intergenic
1185558639 X:1041157-1041179 CAGAGGCCGGGCAGGGAGGCGGG + Intergenic
1185758889 X:2674084-2674106 CAGAGCCCTGAGAAGGAGAAGGG - Intergenic
1186362054 X:8852683-8852705 CAGAGCCCAGTCAAGCAGGCTGG + Intergenic
1186454472 X:9700239-9700261 CAGACCCCGGGGGGTGAGGCAGG + Intronic
1186611093 X:11139126-11139148 CTGGGCCCGGGTATGGAGGCGGG + Exonic
1187252582 X:17612325-17612347 CAGAACCGGGGGAAAGAGGCAGG - Intronic
1187500225 X:19833187-19833209 GAGGGCCCTGGGAAGGAGGGAGG - Intronic
1189278159 X:39802492-39802514 CAGAGGTCGTGGAAGGAGACGGG + Intergenic
1189286268 X:39854456-39854478 CTGGGGCCGGGGAAGGAGGCTGG - Intergenic
1189465745 X:41276447-41276469 CAGAACCCGCGGAGGGAGGAGGG + Intergenic
1190821312 X:53975710-53975732 CAGAGGCTGGGAAAGGAAGCGGG + Intronic
1191624327 X:63253319-63253341 AAGAGCTGGGGGAAGGAGTCAGG + Intergenic
1192201889 X:69071463-69071485 CGGAGCCCGGGCAAGGAGGCTGG - Intergenic
1192260120 X:69501145-69501167 TAAAGCCAGGGGATGGAGGCGGG - Intergenic
1193716207 X:84937176-84937198 TTGAGCCCGGGGAGGGGGGCTGG + Intergenic
1194744347 X:97612040-97612062 CAGGGCACGTGGCAGGAGGCAGG + Intergenic
1195310055 X:103624143-103624165 CTGAGGCCTGGGAAGGAGGCTGG - Intronic
1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG + Intronic
1197279533 X:124518780-124518802 TTGAACCCGGGGAAGGAGTCTGG + Intronic
1197854716 X:130902754-130902776 CAGAGCCAGGGGGAGGGGGGCGG + Intronic
1199666333 X:150099394-150099416 CAGAACCCTGGGAAGGAATCTGG + Intergenic
1199670736 X:150146288-150146310 CAGATGCTGGGGAAGAAGGCAGG - Intergenic