ID: 1162923842

View in Genome Browser
Species Human (GRCh38)
Location 19:13919711-13919733
Sequence AAGGCCCAAGACTCTATAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162923839_1162923842 18 Left 1162923839 19:13919670-13919692 CCTGTCTCAAAAAAAAAAAAATT 0: 184
1: 1411
2: 19122
3: 28463
4: 50155
Right 1162923842 19:13919711-13919733 AAGGCCCAAGACTCTATAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162923842 Original CRISPR AAGGCCCAAGACTCTATAGG TGG Intronic
900088897 1:910652-910674 GAGGCCCAGGACTTTAGAGGTGG + Intergenic
902392048 1:16112579-16112601 GAGGCCCAAGAGCCTAGAGGAGG - Intergenic
904712996 1:32445138-32445160 ATGGCCCATGACTCTGGAGGGGG + Intergenic
912980455 1:114366380-114366402 ATGGCCCACGACTCTGGAGGGGG + Intergenic
921074600 1:211690155-211690177 ATGGCCCATGACTCTGGAGGAGG - Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
1064105885 10:12500683-12500705 AATGCCCAAGCCTCTTTAGCTGG - Intronic
1064819668 10:19312724-19312746 ACAGCCTAAGAGTCTATAGGAGG - Intronic
1065930963 10:30478765-30478787 ATGGCCCACGACTCTGGAGGGGG - Intergenic
1068671835 10:59730887-59730909 ATGGCCCACGACTCTGGAGGGGG + Intronic
1068675836 10:59768442-59768464 ACGGCCCACGACTCTGGAGGGGG + Intergenic
1071072019 10:81705306-81705328 AAGGCCCAAGAGTCCCTGGGAGG - Intergenic
1072391697 10:94993947-94993969 ACGGCCCATGACTCTGGAGGGGG + Intergenic
1083375926 11:62221066-62221088 ATGGCCCATGACTCTGGAGGTGG - Intergenic
1085255767 11:75172130-75172152 AAGGCCATGGACTCTAGAGGCGG - Intronic
1085309008 11:75505274-75505296 AAGGTCCAAGCCTCTATCTGTGG - Intronic
1092554021 12:9536522-9536544 AAATCCCATGAATCTATAGGTGG - Intergenic
1094518076 12:31154105-31154127 AAATCCCATGAATCTATAGGTGG + Intergenic
1096207681 12:49737089-49737111 ATGGCCCACGACTCTGGAGGGGG - Intronic
1100714938 12:97295665-97295687 AAGGCCCAAGACTGTAAGGCAGG + Intergenic
1101553685 12:105786676-105786698 AGGGCTCAGGAATCTATAGGAGG + Intergenic
1102606348 12:114070589-114070611 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1110653752 13:77972849-77972871 ATGGCCCACGACTCTGGAGGGGG + Intergenic
1113394418 13:109933345-109933367 AAGGACCAAAAATCTTTAGGAGG + Intergenic
1114146071 14:19979705-19979727 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1114223580 14:20718414-20718436 ATGGCCCACGACTCTGGAGGGGG + Intergenic
1114236131 14:20825264-20825286 ATGGCCCACGACTCTGGAGGGGG + Intergenic
1115685850 14:35795672-35795694 AAAGCTCAAGAATTTATAGGTGG + Intronic
1116554936 14:46291025-46291047 ATAGCCAAAGACTCTATTGGTGG + Intergenic
1127291035 15:57571435-57571457 AAGGCCCTAAAATCTGTAGGGGG + Intergenic
1130997566 15:88912472-88912494 CAGGGCCAGGACTCTTTAGGTGG - Intronic
1144656384 17:17039935-17039957 AAGGCCTGAGACTCTATAATTGG + Intergenic
1150124819 17:62628942-62628964 GAGGCCCCAGACTCTCCAGGGGG - Intronic
1153398373 18:4651591-4651613 AAGGCCCAATACTCAGAAGGTGG + Intergenic
1154463195 18:14617275-14617297 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1162923842 19:13919711-13919733 AAGGCCCAAGACTCTATAGGTGG + Intronic
1163867131 19:19782914-19782936 ATGGCCCAAGACTCTGGAGGGGG + Intergenic
1163991809 19:21005940-21005962 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1164121610 19:22270281-22270303 ATGGCCCATGACTCTGGAGGGGG + Intergenic
1164130766 19:22359212-22359234 ATGGCCCACGACTCTGGAGGGGG + Intergenic
1164216999 19:23159301-23159323 ATGGCCCATGACTCTGGAGGGGG + Intergenic
1164427371 19:28153627-28153649 AGGGCCCCAGACTCTATAGAAGG - Intergenic
926307975 2:11653317-11653339 AGGGCACAAGACTCTAGGGGAGG - Intergenic
926491498 2:13530381-13530403 ATGGCCCACGACTCTGGAGGGGG + Intergenic
926663606 2:15495292-15495314 AAGGCAGAAAACTGTATAGGTGG - Intronic
933389512 2:81652421-81652443 ATGGCCCACGACTCTGGAGGGGG + Intergenic
935721525 2:105983529-105983551 ATGGCCCACGACTCTGGAGGGGG + Intergenic
938703120 2:133897083-133897105 ATGGCCCAAGACACTGGAGGGGG - Intergenic
940352778 2:152707393-152707415 ATGGCCCATGACTCTGGAGGGGG - Intronic
945483440 2:210367940-210367962 ATGGCCCATGACTCTGGAGGGGG + Intergenic
945720248 2:213410126-213410148 ATGGCCCACGACTCTGGAGGGGG - Intronic
1168824156 20:797998-798020 ATGGCCCACGACTCTGGAGGGGG - Intergenic
1170345563 20:15382819-15382841 CAGGCCCTAGATTCTAGAGGAGG + Intronic
1170374526 20:15685907-15685929 AAGAGCCAACAGTCTATAGGAGG - Intronic
1171866927 20:30492887-30492909 AAGGCCGGAGACGCTATGGGGGG + Intergenic
1172849059 20:37947559-37947581 AAGGCCCAGGTCCCTCTAGGAGG + Intergenic
1176811326 21:13541095-13541117 ATGGCCCATGACTCTGGAGGGGG + Intergenic
1179138849 21:38704653-38704675 AAGGCTCAAGACTCTATTCTTGG - Intergenic
1184691983 22:46121625-46121647 GAGGCCCAGGTCTCTCTAGGTGG + Intergenic
949345857 3:3075956-3075978 AAGGCACAAGACCTTTTAGGAGG - Intronic
950846185 3:16018101-16018123 ATGGCCCATGACTCTGGAGGGGG + Intergenic
952959981 3:38583079-38583101 AGGGCCCTAGACTCTGTGGGTGG - Intronic
953403170 3:42644692-42644714 AAGTCCCAACACTTTAAAGGAGG - Intronic
956975708 3:74576027-74576049 AGGGCCCAACACTCCACAGGAGG - Intergenic
959988516 3:112603932-112603954 GAGGCCCAAGACTTCATTGGAGG + Intergenic
960659578 3:120043254-120043276 ATGGCCCATGACTCTGGAGGTGG - Intronic
960720398 3:120619530-120619552 ATGGCCCATGACTCTGGAGGGGG + Intergenic
962096786 3:132300494-132300516 ATGGCCCACGACTCTGGAGGAGG + Intergenic
962097333 3:132305978-132306000 ATGGCCCACGACTCTGGAGGGGG - Intergenic
963844113 3:150137606-150137628 AAGCCCCAAGACTTTAGATGCGG + Intergenic
966998403 3:185308186-185308208 AGGCCCTAAGACTCTATAGCTGG - Intronic
979834558 4:125347783-125347805 AAGACCCAAGACTTTATAGTAGG + Intronic
982464971 4:155718842-155718864 AGAGCCCAAGAATCAATAGGAGG + Intronic
983761313 4:171409834-171409856 AAGACCCAAGAGATTATAGGAGG + Intergenic
984845454 4:184104355-184104377 CAGGCCCAAGCTTCTAAAGGAGG - Intronic
987930577 5:24395251-24395273 ATGGCCCATGACTCTGGAGGTGG + Intergenic
989096082 5:37782505-37782527 ATGGCCCATGACTCTGGAGGGGG + Intergenic
991201759 5:64002759-64002781 AAGGCCCAAGATTCCTTTGGAGG - Intergenic
991300916 5:65128448-65128470 AAGCCCCATGACTCTGCAGGCGG - Intergenic
994853539 5:105087564-105087586 AACGCCCATGTCTCTGTAGGTGG + Intergenic
998552525 5:143091142-143091164 ATGGCCCACGACTCTGGAGGGGG + Intronic
1000236787 5:159369439-159369461 ATGGCCCACGACTCTGGAGGGGG - Intergenic
1001020253 5:168176663-168176685 ATGGCCCTAGATTCTAGAGGGGG - Intronic
1001558481 5:172652910-172652932 ATGGCCCACGACTCTGGAGGGGG + Intronic
1005461894 6:26077317-26077339 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1005987448 6:30883813-30883835 AAGGCCCCAGACCCTGAAGGCGG - Intronic
1007432166 6:41782992-41783014 GAGGCCCAAGCCTATATAGCTGG + Intronic
1009045823 6:58236870-58236892 GAGGGCTAAGACTCTATAGTAGG + Intergenic
1009221638 6:60991183-60991205 GAGGGCTAAGACTCTATAGTTGG + Intergenic
1010133582 6:72523888-72523910 AAGGCCCGAGAGCCTACAGGAGG + Intergenic
1015171887 6:130263523-130263545 ATGGCCCACGACTCTGGAGGGGG - Intronic
1017711290 6:157170605-157170627 ATGGCTCCAGACTCTGTAGGTGG + Intronic
1020655739 7:10926470-10926492 ATGGCCCACGACTCTGGAGGGGG - Intergenic
1022101581 7:27172610-27172632 ATTGCCCAAGACTCGATAAGGGG + Intronic
1022393429 7:29963208-29963230 AAGGCCCAAGACACTATAAAGGG + Intronic
1023436382 7:40144410-40144432 ATGGCCCATGACTCTGGAGGGGG + Intronic
1028333938 7:89628430-89628452 ATGGCCCACGACTCTGGAGGGGG - Intergenic
1033439765 7:141367957-141367979 AAGGCCCAAGACCCAAGAGAAGG + Intronic
1039876812 8:41593553-41593575 ATGGCCCACGACTCTGGAGGAGG + Intronic
1040278274 8:46024929-46024951 AAGGCCCAGGCCTCTGTAAGAGG + Intergenic
1040278635 8:46026448-46026470 AAGGCCCAGGCCTCCGTAGGAGG + Intergenic
1041515427 8:58694420-58694442 ATGGCCCAGGACTCTGGAGGGGG - Intergenic
1041826746 8:62103069-62103091 AAGGGCCAAGGCTCTGTACGTGG - Intergenic
1043091417 8:75909039-75909061 AAGGCCAAAGACTCAATAATAGG + Intergenic
1046471681 8:114683138-114683160 ATGGCCAAAGACTTTATAGAAGG - Intergenic
1046595128 8:116252268-116252290 AAAGCCAAAGTCTTTATAGGTGG - Intergenic
1047768818 8:128013734-128013756 AAGTCCCAGGACACTATATGTGG - Intergenic
1060248259 9:121964721-121964743 AAGGCACAAGGCTCTGTTGGGGG - Intronic
1190771180 X:53516021-53516043 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1191084996 X:56556756-56556778 AATTCCCAAGACTCTAGAGATGG - Intergenic
1196460027 X:115920115-115920137 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1196869367 X:120098343-120098365 ATGGCCCATGACTCTGGAGGGGG - Intergenic