ID: 1162924086

View in Genome Browser
Species Human (GRCh38)
Location 19:13920951-13920973
Sequence GAGCCTGACAAGTGGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162924086_1162924094 21 Left 1162924086 19:13920951-13920973 CCAGGCACCCACTTGTCAGGCTC 0: 1
1: 1
2: 0
3: 21
4: 162
Right 1162924094 19:13920995-13921017 AACTAGAAGTGTATTAGTCAAGG 0: 1
1: 0
2: 4
3: 36
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162924086 Original CRISPR GAGCCTGACAAGTGGGTGCC TGG (reversed) Intronic