ID: 1162924455

View in Genome Browser
Species Human (GRCh38)
Location 19:13923288-13923310
Sequence CGGGGGTAAGGAGGACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162924455_1162924470 24 Left 1162924455 19:13923288-13923310 CCTGCTTGTCCTCCTTACCCCCG 0: 1
1: 0
2: 2
3: 18
4: 198
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1162924455_1162924463 0 Left 1162924455 19:13923288-13923310 CCTGCTTGTCCTCCTTACCCCCG 0: 1
1: 0
2: 2
3: 18
4: 198
Right 1162924463 19:13923311-13923333 CCACCAGCCTCGTCCTCCCCAGG 0: 1
1: 1
2: 72
3: 1202
4: 2884

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162924455 Original CRISPR CGGGGGTAAGGAGGACAAGC AGG (reversed) Intronic