ID: 1162924456

View in Genome Browser
Species Human (GRCh38)
Location 19:13923297-13923319
Sequence GGCTGGTGGCGGGGGTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 834
Summary {0: 1, 1: 0, 2: 8, 3: 73, 4: 752}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162924456_1162924463 -9 Left 1162924456 19:13923297-13923319 CCTCCTTACCCCCGCCACCAGCC 0: 1
1: 0
2: 8
3: 73
4: 752
Right 1162924463 19:13923311-13923333 CCACCAGCCTCGTCCTCCCCAGG 0: 1
1: 1
2: 72
3: 1202
4: 2884
1162924456_1162924470 15 Left 1162924456 19:13923297-13923319 CCTCCTTACCCCCGCCACCAGCC 0: 1
1: 0
2: 8
3: 73
4: 752
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1162924456_1162924476 30 Left 1162924456 19:13923297-13923319 CCTCCTTACCCCCGCCACCAGCC 0: 1
1: 0
2: 8
3: 73
4: 752
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162924456 Original CRISPR GGCTGGTGGCGGGGGTAAGG AGG (reversed) Intronic