ID: 1162924457

View in Genome Browser
Species Human (GRCh38)
Location 19:13923300-13923322
Sequence CGAGGCTGGTGGCGGGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 416}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162924457_1162924476 27 Left 1162924457 19:13923300-13923322 CCTTACCCCCGCCACCAGCCTCG 0: 1
1: 0
2: 0
3: 39
4: 416
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924457_1162924470 12 Left 1162924457 19:13923300-13923322 CCTTACCCCCGCCACCAGCCTCG 0: 1
1: 0
2: 0
3: 39
4: 416
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162924457 Original CRISPR CGAGGCTGGTGGCGGGGGTA AGG (reversed) Intronic