ID: 1162924458

View in Genome Browser
Species Human (GRCh38)
Location 19:13923305-13923327
Sequence GAGGACGAGGCTGGTGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 830
Summary {0: 1, 1: 0, 2: 4, 3: 80, 4: 745}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162924458_1162924477 30 Left 1162924458 19:13923305-13923327 CCCCCGCCACCAGCCTCGTCCTC 0: 1
1: 0
2: 4
3: 80
4: 745
Right 1162924477 19:13923358-13923380 ACGACTTTGCCCTGGTCCAGCGG 0: 1
1: 0
2: 1
3: 7
4: 87
1162924458_1162924470 7 Left 1162924458 19:13923305-13923327 CCCCCGCCACCAGCCTCGTCCTC 0: 1
1: 0
2: 4
3: 80
4: 745
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1162924458_1162924476 22 Left 1162924458 19:13923305-13923327 CCCCCGCCACCAGCCTCGTCCTC 0: 1
1: 0
2: 4
3: 80
4: 745
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162924458 Original CRISPR GAGGACGAGGCTGGTGGCGG GGG (reversed) Intronic