ID: 1162924462

View in Genome Browser
Species Human (GRCh38)
Location 19:13923311-13923333
Sequence CCTGGGGAGGACGAGGCTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87444
Summary {0: 1, 1: 8, 2: 780, 3: 3898, 4: 82757}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162924462_1162924476 16 Left 1162924462 19:13923311-13923333 CCACCAGCCTCGTCCTCCCCAGG 0: 1
1: 8
2: 780
3: 3898
4: 82757
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924462_1162924470 1 Left 1162924462 19:13923311-13923333 CCACCAGCCTCGTCCTCCCCAGG 0: 1
1: 8
2: 780
3: 3898
4: 82757
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1162924462_1162924478 29 Left 1162924462 19:13923311-13923333 CCACCAGCCTCGTCCTCCCCAGG 0: 1
1: 8
2: 780
3: 3898
4: 82757
Right 1162924478 19:13923363-13923385 TTTGCCCTGGTCCAGCGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1162924462_1162924477 24 Left 1162924462 19:13923311-13923333 CCACCAGCCTCGTCCTCCCCAGG 0: 1
1: 8
2: 780
3: 3898
4: 82757
Right 1162924477 19:13923358-13923380 ACGACTTTGCCCTGGTCCAGCGG 0: 1
1: 0
2: 1
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162924462 Original CRISPR CCTGGGGAGGACGAGGCTGG TGG (reversed) Exonic