ID: 1162924465

View in Genome Browser
Species Human (GRCh38)
Location 19:13923318-13923340
Sequence GGCGGCACCTGGGGAGGACG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1629
Summary {0: 1, 1: 0, 2: 7, 3: 51, 4: 1570}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162924465_1162924481 27 Left 1162924465 19:13923318-13923340 CCTCGTCCTCCCCAGGTGCCGCC 0: 1
1: 0
2: 7
3: 51
4: 1570
Right 1162924481 19:13923368-13923390 CCTGGTCCAGCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 36
4: 309
1162924465_1162924470 -6 Left 1162924465 19:13923318-13923340 CCTCGTCCTCCCCAGGTGCCGCC 0: 1
1: 0
2: 7
3: 51
4: 1570
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1162924465_1162924478 22 Left 1162924465 19:13923318-13923340 CCTCGTCCTCCCCAGGTGCCGCC 0: 1
1: 0
2: 7
3: 51
4: 1570
Right 1162924478 19:13923363-13923385 TTTGCCCTGGTCCAGCGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1162924465_1162924482 28 Left 1162924465 19:13923318-13923340 CCTCGTCCTCCCCAGGTGCCGCC 0: 1
1: 0
2: 7
3: 51
4: 1570
Right 1162924482 19:13923369-13923391 CTGGTCCAGCGGCCTGGCCCGGG 0: 1
1: 0
2: 2
3: 36
4: 264
1162924465_1162924477 17 Left 1162924465 19:13923318-13923340 CCTCGTCCTCCCCAGGTGCCGCC 0: 1
1: 0
2: 7
3: 51
4: 1570
Right 1162924477 19:13923358-13923380 ACGACTTTGCCCTGGTCCAGCGG 0: 1
1: 0
2: 1
3: 7
4: 87
1162924465_1162924476 9 Left 1162924465 19:13923318-13923340 CCTCGTCCTCCCCAGGTGCCGCC 0: 1
1: 0
2: 7
3: 51
4: 1570
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162924465 Original CRISPR GGCGGCACCTGGGGAGGACG AGG (reversed) Exonic