ID: 1162924470

View in Genome Browser
Species Human (GRCh38)
Location 19:13923335-13923357
Sequence GCCGCCTGCCCCTGTCAACA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 152}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162924465_1162924470 -6 Left 1162924465 19:13923318-13923340 CCTCGTCCTCCCCAGGTGCCGCC 0: 1
1: 0
2: 7
3: 51
4: 1570
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1162924464_1162924470 -2 Left 1162924464 19:13923314-13923336 CCAGCCTCGTCCTCCCCAGGTGC 0: 1
1: 28
2: 2792
3: 96349
4: 251169
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1162924461_1162924470 4 Left 1162924461 19:13923308-13923330 CCGCCACCAGCCTCGTCCTCCCC 0: 1
1: 0
2: 4
3: 112
4: 1196
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1162924459_1162924470 6 Left 1162924459 19:13923306-13923328 CCCCGCCACCAGCCTCGTCCTCC 0: 1
1: 0
2: 1
3: 72
4: 697
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1162924460_1162924470 5 Left 1162924460 19:13923307-13923329 CCCGCCACCAGCCTCGTCCTCCC 0: 1
1: 0
2: 17
3: 314
4: 2820
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1162924458_1162924470 7 Left 1162924458 19:13923305-13923327 CCCCCGCCACCAGCCTCGTCCTC 0: 1
1: 0
2: 4
3: 80
4: 745
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1162924456_1162924470 15 Left 1162924456 19:13923297-13923319 CCTCCTTACCCCCGCCACCAGCC 0: 1
1: 0
2: 8
3: 73
4: 752
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1162924455_1162924470 24 Left 1162924455 19:13923288-13923310 CCTGCTTGTCCTCCTTACCCCCG 0: 1
1: 0
2: 2
3: 18
4: 198
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1162924462_1162924470 1 Left 1162924462 19:13923311-13923333 CCACCAGCCTCGTCCTCCCCAGG 0: 1
1: 8
2: 780
3: 3898
4: 82757
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1162924457_1162924470 12 Left 1162924457 19:13923300-13923322 CCTTACCCCCGCCACCAGCCTCG 0: 1
1: 0
2: 0
3: 39
4: 416
Right 1162924470 19:13923335-13923357 GCCGCCTGCCCCTGTCAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162924470 Original CRISPR GCCGCCTGCCCCTGTCAACA AGG Exonic