ID: 1162924476

View in Genome Browser
Species Human (GRCh38)
Location 19:13923350-13923372
Sequence CAACAAGGACGACTTTGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 56}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162924468_1162924476 -1 Left 1162924468 19:13923328-13923350 CCCAGGTGCCGCCTGCCCCTGTC 0: 1
1: 0
2: 2
3: 21
4: 256
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924456_1162924476 30 Left 1162924456 19:13923297-13923319 CCTCCTTACCCCCGCCACCAGCC 0: 1
1: 0
2: 8
3: 73
4: 752
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924459_1162924476 21 Left 1162924459 19:13923306-13923328 CCCCGCCACCAGCCTCGTCCTCC 0: 1
1: 0
2: 1
3: 72
4: 697
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924471_1162924476 -9 Left 1162924471 19:13923336-13923358 CCGCCTGCCCCTGTCAACAAGGA 0: 1
1: 0
2: 0
3: 25
4: 304
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924461_1162924476 19 Left 1162924461 19:13923308-13923330 CCGCCACCAGCCTCGTCCTCCCC 0: 1
1: 0
2: 4
3: 112
4: 1196
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924462_1162924476 16 Left 1162924462 19:13923311-13923333 CCACCAGCCTCGTCCTCCCCAGG 0: 1
1: 8
2: 780
3: 3898
4: 82757
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924457_1162924476 27 Left 1162924457 19:13923300-13923322 CCTTACCCCCGCCACCAGCCTCG 0: 1
1: 0
2: 0
3: 39
4: 416
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924465_1162924476 9 Left 1162924465 19:13923318-13923340 CCTCGTCCTCCCCAGGTGCCGCC 0: 1
1: 0
2: 7
3: 51
4: 1570
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924466_1162924476 3 Left 1162924466 19:13923324-13923346 CCTCCCCAGGTGCCGCCTGCCCC 0: 1
1: 0
2: 3
3: 91
4: 564
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924460_1162924476 20 Left 1162924460 19:13923307-13923329 CCCGCCACCAGCCTCGTCCTCCC 0: 1
1: 0
2: 17
3: 314
4: 2820
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924469_1162924476 -2 Left 1162924469 19:13923329-13923351 CCAGGTGCCGCCTGCCCCTGTCA 0: 1
1: 0
2: 1
3: 23
4: 255
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924458_1162924476 22 Left 1162924458 19:13923305-13923327 CCCCCGCCACCAGCCTCGTCCTC 0: 1
1: 0
2: 4
3: 80
4: 745
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924464_1162924476 13 Left 1162924464 19:13923314-13923336 CCAGCCTCGTCCTCCCCAGGTGC 0: 1
1: 28
2: 2792
3: 96349
4: 251169
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162924467_1162924476 0 Left 1162924467 19:13923327-13923349 CCCCAGGTGCCGCCTGCCCCTGT 0: 1
1: 0
2: 1
3: 21
4: 298
Right 1162924476 19:13923350-13923372 CAACAAGGACGACTTTGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162924476 Original CRISPR CAACAAGGACGACTTTGCCC TGG Exonic