ID: 1162924478

View in Genome Browser
Species Human (GRCh38)
Location 19:13923363-13923385
Sequence TTTGCCCTGGTCCAGCGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 118}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162924472_1162924478 1 Left 1162924472 19:13923339-13923361 CCTGCCCCTGTCAACAAGGACGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1162924478 19:13923363-13923385 TTTGCCCTGGTCCAGCGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1162924468_1162924478 12 Left 1162924468 19:13923328-13923350 CCCAGGTGCCGCCTGCCCCTGTC 0: 1
1: 0
2: 2
3: 21
4: 256
Right 1162924478 19:13923363-13923385 TTTGCCCTGGTCCAGCGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1162924469_1162924478 11 Left 1162924469 19:13923329-13923351 CCAGGTGCCGCCTGCCCCTGTCA 0: 1
1: 0
2: 1
3: 23
4: 255
Right 1162924478 19:13923363-13923385 TTTGCCCTGGTCCAGCGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1162924471_1162924478 4 Left 1162924471 19:13923336-13923358 CCGCCTGCCCCTGTCAACAAGGA 0: 1
1: 0
2: 0
3: 25
4: 304
Right 1162924478 19:13923363-13923385 TTTGCCCTGGTCCAGCGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1162924465_1162924478 22 Left 1162924465 19:13923318-13923340 CCTCGTCCTCCCCAGGTGCCGCC 0: 1
1: 0
2: 7
3: 51
4: 1570
Right 1162924478 19:13923363-13923385 TTTGCCCTGGTCCAGCGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1162924466_1162924478 16 Left 1162924466 19:13923324-13923346 CCTCCCCAGGTGCCGCCTGCCCC 0: 1
1: 0
2: 3
3: 91
4: 564
Right 1162924478 19:13923363-13923385 TTTGCCCTGGTCCAGCGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1162924474_1162924478 -4 Left 1162924474 19:13923344-13923366 CCCTGTCAACAAGGACGACTTTG 0: 1
1: 0
2: 0
3: 12
4: 421
Right 1162924478 19:13923363-13923385 TTTGCCCTGGTCCAGCGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1162924467_1162924478 13 Left 1162924467 19:13923327-13923349 CCCCAGGTGCCGCCTGCCCCTGT 0: 1
1: 0
2: 1
3: 21
4: 298
Right 1162924478 19:13923363-13923385 TTTGCCCTGGTCCAGCGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1162924475_1162924478 -5 Left 1162924475 19:13923345-13923367 CCTGTCAACAAGGACGACTTTGC 0: 1
1: 0
2: 0
3: 0
4: 73
Right 1162924478 19:13923363-13923385 TTTGCCCTGGTCCAGCGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1162924473_1162924478 -3 Left 1162924473 19:13923343-13923365 CCCCTGTCAACAAGGACGACTTT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1162924478 19:13923363-13923385 TTTGCCCTGGTCCAGCGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1162924462_1162924478 29 Left 1162924462 19:13923311-13923333 CCACCAGCCTCGTCCTCCCCAGG 0: 1
1: 8
2: 780
3: 3898
4: 82757
Right 1162924478 19:13923363-13923385 TTTGCCCTGGTCCAGCGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1162924464_1162924478 26 Left 1162924464 19:13923314-13923336 CCAGCCTCGTCCTCCCCAGGTGC 0: 1
1: 28
2: 2792
3: 96349
4: 251169
Right 1162924478 19:13923363-13923385 TTTGCCCTGGTCCAGCGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162924478 Original CRISPR TTTGCCCTGGTCCAGCGGCC TGG Exonic